Regulon of AraR in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_02213
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacteroidaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - NrtR
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -94 Score: 5.6 Sequence: TTAGTGTTACTAATACACTTT Locus tag: BACPLE_02216 Name: araP Funciton: Predicted sodium-dependent arabinose transporter, MFS family
	BACPLE_02216	araP	Predicted sodium-dependent arabinose transporter, MFS family
Position: -45 Score: 5.6 Sequence: TAAGTGTTACTTTTACACCAT Locus tag: BACPLE_02214 Name: araM Funciton: L-arabinose mutarotase Locus tag: BACPLE_02213 Name: araR Funciton: Transcriptional regulator for arabinose utilization, NrtR family Locus tag: BACPLE_02212 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BACPLE_02211 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BACPLE_02210 Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
	BACPLE_02214	araM	L-arabinose mutarotase
	BACPLE_02213	araR	Transcriptional regulator for arabinose utilization, NrtR family
	BACPLE_02212	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	BACPLE_02211	araA	L-arabinose isomerase (EC 5.3.1.4)
	BACPLE_02210	araB	Ribulokinase (EC 2.7.1.16)
Position: -81 Score: 4.5 Sequence: AAAATGTCAAATGTACACCCA Position: -33 Score: 4.4 Sequence: AAAGTGTGAAATAAACAAGTA Locus tag: BACPLE_02644 Name: abf1 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
	BACPLE_02644	abf1	Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD