Regulog HomR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Methionine metabolism; Cysteine metabolism
Effector:	O-acetyl-L-serine
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Methionine metabolism
By pathway - Cysteine metabolism

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	1	1
Lactococcus lactis subsp. lactis Il1403	3	2
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34	10	4
Streptococcus gordonii str. Challis substr. CH1	2	1
Streptococcus mitis B6	2	1
Streptococcus mutans UA159	10	4
Streptococcus pneumoniae TIGR4	2	1
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36	2	1
Streptococcus suis 05ZYH33	2	1
Streptococcus thermophilus CNRZ1066	4	2
Streptococcus uberis 0140J

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
GALLO_1277	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -113 score = 5.72473 sequence = GTTATAAAAAAATCTTATCAC Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulator HomR, LysR family	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -110 score = 5.20554 sequence = GCCATAAGAAAAAGTTATCAC Site: position = -175 score = 6.06284 sequence = GCTATAAATTTTATTTATGAC Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulator HomR, LysR family	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str0452: Homocysteine biosynthesis transcriptional regulator HomR, LysR family	Streptococcus uberis 0140J	Homocysteine biosynthesis transcriptional regulator HomR, LysR family

CRON 2.
metB	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403 Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -142 score = 5.92684 sequence = GTTATAGTTTTTACTTATAGC Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus mitis B6 Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48)	* Streptococcus mutans UA159 Site: position = -110 score = 4.85059 sequence = CTTATAGTTTCTTTTTATAGC Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus pneumoniae TIGR4 Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus suis 05ZYH33 Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48)	* Streptococcus thermophilus CNRZ1066 Site: position = -132 score = 5.38269 sequence = GTTATAGTAATAAACTATATC Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus uberis 0140J	Cystathionine gamma-synthase (EC 2.5.1.48)
metC	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_2187: L-cysteine desulfhydrase	Lactococcus lactis subsp. lactis Il1403 Gene: L177593: L-cysteine desulfhydrase	Streptococcus agalactiae 2603V/R Gene: SAG1587: L-cysteine desulfhydrase	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1767: L-cysteine desulfhydrase	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1635: L-cysteine desulfhydrase	Streptococcus mitis B6 Gene: smi_1507: L-cysteine desulfhydrase	Streptococcus mutans UA159 Gene: SMU.1674: L-cysteine desulfhydrase	Streptococcus pneumoniae TIGR4 Gene: SP_1524: L-cysteine desulfhydrase	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1736: L-cysteine desulfhydrase	Streptococcus suis 05ZYH33 Gene: SSU05_1561: L-cysteine desulfhydrase	Streptococcus thermophilus CNRZ1066 Gene: str0353: L-cysteine desulfhydrase	Streptococcus uberis 0140J Gene: SUB0427: L-cysteine desulfhydrase	L-cysteine desulfhydrase

CRON 3.
tcyD	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -104 score = 5.58477 sequence = GCTATAAGCAAATCTTATGGC Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -168 score = 5.20554 sequence = GTGATAACTTTTTCTTATGGC Site: position = -103 score = 6.06284 sequence = GTCATAAATAAAATTTATAGC Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	2 Streptococcus sanguinis SK36 Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted uroporphyrinogen-III decarboxylase
tcyE	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, substrate-binding protein
tcyF	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, permease protein 1
tcyG	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, permease protein 2
tcyH	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, ATP-binding protein

CRON 4.
metE	Lactococcus lactis subsp. cremoris SK11	* Lactococcus lactis subsp. lactis Il1403 Site: position = -99 score = 4.30632 sequence = CATATAGTTTAAAACTATAGG Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus agalactiae 2603V/R Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -172 score = 5.16523 sequence = GTTATAGTTAAAAACTATAAT Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -99 score = 4.58554 sequence = GATATAGTTTTTGGCTATATC Site: position = -182 score = 5.17389 sequence = GTTATAGTTTTTGATTATACC Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus mitis B6 Site: position = -101 score = 4.76119 sequence = GATATAGTTTCAAACTATATC Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus mutans UA159 Site: position = -188 score = 5.3623 sequence = GTTATAGATGAAAACTATAAC Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus pneumoniae TIGR4 Site: position = -218 score = 4.95056 sequence = CTTATAAGAATTACTAATAAC Site: position = -251 score = 5.01095 sequence = GTTATAGTCTTTTCTAATAAC Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus pyogenes M1 GAS	* Streptococcus sanguinis SK36 Site: position = -182 score = 5.31664 sequence = GTCATAATTTCTACCTATAGC Site: position = -99 score = 5.18785 sequence = GTTATAGTTTTAGACTATATC Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus suis 05ZYH33 Site: position = -237 score = 4.7159 sequence = TTCATAGATAAAATCTATACC Site: position = -101 score = 4.83192 sequence = GTTATAGTCAAAAGTTATACC Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus thermophilus CNRZ1066 Site: position = -60 score = 4.64455 sequence = GATATAGTTTAAAACTATATA Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus uberis 0140J	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metH	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403 Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus mitis B6 Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus suis 05ZYH33 Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus thermophilus CNRZ1066 Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus uberis 0140J	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

CRON 5.
metB2	* Lactococcus lactis subsp. cremoris SK11 Site: position = -80 score = 4.82647 sequence = GACATAGCATTTTCTTATGGC Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1)	* Lactococcus lactis subsp. lactis Il1403 Site: position = -79 score = 5.97337 sequence = GCTATAAAAAAATCTTATAGC Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1)	Streptococcus uberis 0140J	Cystathionine gamma-lyase (EC 4.4.1.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HomR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --