Regulog HomR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | activator |
| Biological process: | Methionine metabolism; Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LysR
- By effector - O-acetyl-L-serine
- By pathway - Methionine metabolism
- By pathway - Cysteine metabolism
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 1 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | 3 | 2 |
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | 10 | 4 |
| Streptococcus gordonii str. Challis substr. CH1 | 2 | 1 |
| Streptococcus mitis B6 | 2 | 1 |
| Streptococcus mutans UA159 | 10 | 4 |
| Streptococcus pneumoniae TIGR4 | 2 | 1 |
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | 2 | 1 |
| Streptococcus suis 05ZYH33 | 2 | 1 |
| Streptococcus thermophilus CNRZ1066 | 4 | 2 |
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| GALLO_1277 |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -113 score = 5.72473 sequence = GTTATAAAAAAATCTTATCAC Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulator HomR, LysR family |
|
|
*
Streptococcus mutans UA159 Site: position = -110 score = 5.20554 sequence = GCCATAAGAAAAAGTTATCAC Site: position = -175 score = 6.06284 sequence = GCTATAAATTTTATTTATGAC Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulator HomR, LysR family |
|
|
|
|
Gene: str0452: Homocysteine biosynthesis transcriptional regulator HomR, LysR family |
|
Homocysteine biosynthesis transcriptional regulator HomR, LysR family |
| CRON 2. | ||||||||||||||||
| metB |
|
Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -142 score = 5.92684 sequence = GTTATAGTTTTTACTTATAGC Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48) |
*
Streptococcus mutans UA159 Site: position = -110 score = 4.85059 sequence = CTTATAGTTTCTTTTTATAGC Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -132 score = 5.38269 sequence = GTTATAGTAATAAACTATATC Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
Cystathionine gamma-synthase (EC 2.5.1.48) |
| metC |
Gene: LACR_2187: L-cysteine desulfhydrase |
Gene: L177593: L-cysteine desulfhydrase |
Gene: SAG1587: L-cysteine desulfhydrase |
|
|
Gene: GALLO_1767: L-cysteine desulfhydrase |
Gene: SGO_1635: L-cysteine desulfhydrase |
Gene: smi_1507: L-cysteine desulfhydrase |
Gene: SMU.1674: L-cysteine desulfhydrase |
Gene: SP_1524: L-cysteine desulfhydrase |
|
Gene: SSA_1736: L-cysteine desulfhydrase |
Gene: SSU05_1561: L-cysteine desulfhydrase |
Gene: str0353: L-cysteine desulfhydrase |
Gene: SUB0427: L-cysteine desulfhydrase |
L-cysteine desulfhydrase |
| CRON 3. | ||||||||||||||||
| tcyD |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -104 score = 5.58477 sequence = GCTATAAGCAAATCTTATGGC Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase |
|
|
*
Streptococcus mutans UA159 Site: position = -168 score = 5.20554 sequence = GTGATAACTTTTTCTTATGGC Site: position = -103 score = 6.06284 sequence = GTCATAAATAAAATTTATAGC Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase |
|
|
2
Streptococcus sanguinis SK36 Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase |
|
|
|
Predicted uroporphyrinogen-III decarboxylase |
| tcyE |
|
|
|
|
|
Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
|
Predicted cysteine ABC transporter, substrate-binding protein |
| tcyF |
|
|
|
|
|
Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1 |
|
|
Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1 |
|
|
Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1 |
|
|
|
Predicted cysteine ABC transporter, permease protein 1 |
| tcyG |
|
|
|
|
|
Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2 |
|
|
Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2 |
|
|
Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2 |
|
|
|
Predicted cysteine ABC transporter, permease protein 2 |
| tcyH |
|
|
|
|
|
Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
|
Predicted cysteine ABC transporter, ATP-binding protein |
| CRON 4. | ||||||||||||||||
| metE |
|
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -99 score = 4.30632 sequence = CATATAGTTTAAAACTATAGG Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -172 score = 5.16523 sequence = GTTATAGTTAAAAACTATAAT Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -99 score = 4.58554 sequence = GATATAGTTTTTGGCTATATC Site: position = -182 score = 5.17389 sequence = GTTATAGTTTTTGATTATACC Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus mitis B6 Site: position = -101 score = 4.76119 sequence = GATATAGTTTCAAACTATATC Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus mutans UA159 Site: position = -188 score = 5.3623 sequence = GTTATAGATGAAAACTATAAC Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus pneumoniae TIGR4 Site: position = -218 score = 4.95056 sequence = CTTATAAGAATTACTAATAAC Site: position = -251 score = 5.01095 sequence = GTTATAGTCTTTTCTAATAAC Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
*
Streptococcus sanguinis SK36 Site: position = -182 score = 5.31664 sequence = GTCATAATTTCTACCTATAGC Site: position = -99 score = 5.18785 sequence = GTTATAGTTTTAGACTATATC Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus suis 05ZYH33 Site: position = -237 score = 4.7159 sequence = TTCATAGATAAAATCTATACC Site: position = -101 score = 4.83192 sequence = GTTATAGTCAAAAGTTATACC Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -60 score = 4.64455 sequence = GATATAGTTTAAAACTATATA Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
| metH |
|
|
Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
|
Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
|
Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
|
|
|
|
|
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
| metF |
|
Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
|
|
|
Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
| CRON 5. | ||||||||||||||||
| metB2 |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -80 score = 4.82647 sequence = GACATAGCATTTTCTTATGGC Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -79 score = 5.97337 sequence = GCTATAAAAAAATCTTATAGC Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1) |
|
|
|
|
|
|
|
|
|
|
|
Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1) |
|
Cystathionine gamma-lyase (EC 4.4.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |