Regulon of HomR in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.930c
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Methionine metabolism; Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	HomR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Methionine metabolism
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -188 Score: 5.4 Sequence: GTTATAGATGAAAACTATAAC Locus tag: SMU.873 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: SMU.874 Name: metH Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	SMU.873	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	SMU.874	metH	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -168 Score: 5.2 Sequence: GTGATAACTTTTTCTTATGGC Position: -103 Score: 6.1 Sequence: GTCATAAATAAAATTTATAGC Locus tag: SMU.932 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SMU.933 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: SMU.934 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: SMU.935 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: SMU.936 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
	SMU.932	tcyD	Predicted uroporphyrinogen-III decarboxylase
	SMU.933	tcyE	Predicted cysteine ABC transporter, substrate-binding protein
	SMU.934	tcyF	Predicted cysteine ABC transporter, permease protein 1
	SMU.935	tcyG	Predicted cysteine ABC transporter, permease protein 2
	SMU.936	tcyH	Predicted cysteine ABC transporter, ATP-binding protein
Position: -175 Score: 6.1 Sequence: GCTATAAATTTTATTTATGAC Position: -110 Score: 5.2 Sequence: GCCATAAGAAAAAGTTATCAC Locus tag: SMU.930c Name: GALLO_1277 Funciton: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
	SMU.930c	GALLO_1277	Homocysteine biosynthesis transcriptional regulator HomR, LysR family
Position: -110 Score: 4.9 Sequence: CTTATAGTTTCTTTTTATAGC Locus tag: SMU.1675 Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) Locus tag: SMU.1674 Name: metC Funciton: L-cysteine desulfhydrase
	SMU.1675	metB	Cystathionine gamma-synthase (EC 2.5.1.48)
	SMU.1674	metC	L-cysteine desulfhydrase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD