Regulon of HomR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_1277
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Methionine metabolism; Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	HomR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Methionine metabolism
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 5.2 Sequence: GTTATAGTTAAAAACTATAAT Locus tag: GALLO_1316 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: GALLO_1315 Name: metH Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	GALLO_1316	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	GALLO_1315	metH	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -113 Score: 5.7 Sequence: GTTATAAAAAAATCTTATCAC Locus tag: GALLO_1277 Name: GALLO_1277 Funciton: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
	GALLO_1277	GALLO_1277	Homocysteine biosynthesis transcriptional regulator HomR, LysR family
Position: -104 Score: 5.6 Sequence: GCTATAAGCAAATCTTATGGC Locus tag: GALLO_1275 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: GALLO_1274 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: GALLO_1273 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: GALLO_1272 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: GALLO_1271 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
	GALLO_1275	tcyD	Predicted uroporphyrinogen-III decarboxylase
	GALLO_1274	tcyE	Predicted cysteine ABC transporter, substrate-binding protein
	GALLO_1273	tcyF	Predicted cysteine ABC transporter, permease protein 1
	GALLO_1272	tcyG	Predicted cysteine ABC transporter, permease protein 2
	GALLO_1271	tcyH	Predicted cysteine ABC transporter, ATP-binding protein
Position: -142 Score: 5.9 Sequence: GTTATAGTTTTTACTTATAGC Locus tag: GALLO_1768 Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) Locus tag: GALLO_1767 Name: metC Funciton: L-cysteine desulfhydrase
	GALLO_1768	metB	Cystathionine gamma-synthase (EC 2.5.1.48)
	GALLO_1767	metC	L-cysteine desulfhydrase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD