Regulon of HomR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Methionine metabolism; Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	HomR - Streptococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Methionine metabolism
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 4.8 Sequence: GACATAGCATTTTCTTATGGC Locus tag: LACR_0831 Name: metB2 Funciton: Cystathionine gamma-lyase (EC 4.4.1.1)
	LACR_0831	metB2	Cystathionine gamma-lyase (EC 4.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD