Regulog HrcA - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | 3 | 2 |
| Corynebacterium aurimucosum ATCC 700975 | 3 | 2 |
| Corynebacterium diphtheriae NCTC 13129 | 3 | 2 |
| Corynebacterium efficiens YS-314 | 3 | 2 |
| Corynebacterium glutamicum ATCC 13032 | 5 | 2 |
| Corynebacterium jeikeium K411 | 3 | 2 |
| Corynebacterium kroppenstedtii DSM 44385 | 3 | 2 |
| Corynebacterium urealyticum DSM 7109 | 3 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| groL2 |
*
Corynebacterium amycolatum SK46 Site: position = -249 score = 6.24379 sequence = CTTGCACTCGATGGGGTTGAGTGCTAG Site: position = -213 score = 7.16495 sequence = TTAGCACTTGCTCTAATTGAGTGCTAA Gene: CORAM0001_1328: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -184 score = 5.09539 sequence = CTTGCAGTCGGTAGGCCTGAGTGCCAG Site: position = -149 score = 5.18274 sequence = CTAGCACTTCCACATGGCAAGTGCCAG Gene: cauri_2263: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -218 score = 6.01726 sequence = CTTGCACTCGTACCCGTAGACTGCTAA Site: position = -184 score = 7.07446 sequence = TTAGCACTCGATCTAACCGAGTGCTAA Gene: DIP2020: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium efficiens YS-314 Site: position = -182 score = 6.73294 sequence = CTTGCACTCGACATGGGCGAGTGCTAG Site: position = -148 score = 5.71586 sequence = TTAGCACTTACCTCGTATGAGTGCCAG Gene: CE2561: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -148 score = 5.16384 sequence = TTAGCACTCAACTAATCAGAGTGCCAA Site: position = -183 score = 6.97906 sequence = CTTGCACTCACACCCCTTGAGTGCTAG Gene: cg3011: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium jeikeium K411 Site: position = -181 score = 5.03112 sequence = CTTGCAGTCGATGGGGGAGAGTGCTAA Site: position = -146 score = 6.01326 sequence = TTAGCACTTGAAGTAAGGGAGTGCCAG Gene: jk0267: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium kroppenstedtii DSM 44385 Site: position = -184 score = 5.40198 sequence = CTTGCACTCTAAGCCCGAGACTGCTAA Gene: ckrop_1667: Heat shock protein 60 family chaperone GroEL |
*
Corynebacterium urealyticum DSM 7109 Site: position = -183 score = 5.21999 sequence = CTTGCACTCAAGGGGTGCGAGTGCTAA Site: position = -148 score = 7.00711 sequence = TTAGCACTTGCACTGGTTGAGTGCCAG Gene: cur_1716: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 2. | |||||||||
| groS |
*
Corynebacterium amycolatum SK46 Site: position = -154 score = 5.99809 sequence = TTAGCGCTCACTATGGTTGAGTGTTAG Site: position = -131 score = 5.83441 sequence = TTAGCACTTGCAGGGGTAGAGTGCTAA Gene: CORAM0001_0268: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -144 score = 5.48247 sequence = CTAGCAGTCGCGAGGGTAGAGTGCTAG Gene: cauri_0474: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -124 score = 5.24143 sequence = CTGGCACTCTCAGGGGTAGAGTGCCAG Gene: DIP0575: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium efficiens YS-314 Site: position = -134 score = 5.25035 sequence = TTAGCACCCTTAGCGGTTGAGTGCTGG Gene: CE0601: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -147 score = 5.86435 sequence = TTAGCACCCTCAACAGTTGAGTGCTGG Gene: cg0690: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium jeikeium K411 Site: position = -145 score = 5.68777 sequence = TTAGCACTTGCGAGGGTAGAGTGCCAG Gene: jk1729: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium kroppenstedtii DSM 44385 Site: position = -129 score = 5.66182 sequence = CTGGCACTCACACGGGTAGAGTGCCAA Site: position = -152 score = 5.18438 sequence = TTAGCACTCCCGGTGGTTGAGAGCTGG Gene: ckrop_1737: Heat shock protein 60 family co-chaperone GroES |
*
Corynebacterium urealyticum DSM 7109 Site: position = -11 score = 5.26595 sequence = TTAGCACTTGGGTGGGTAGAGTGCTAG Gene: cur_0393: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL1 |
Gene: CORAM0001_0269: Heat shock protein 60 family chaperone GroEL |
Gene: cauri_0475: Heat shock protein 60 family chaperone GroEL |
Gene: DIP0576: Heat shock protein 60 family chaperone GroEL |
Gene: CE0602: Heat shock protein 60 family chaperone GroEL |
2
Corynebacterium glutamicum ATCC 13032 Gene: cg0693: Heat shock protein 60 family chaperone GroEL Gene: cg0691: Heat shock protein 60 family chaperone GroEL |
Gene: jk1728: Heat shock protein 60 family chaperone GroEL |
Gene: ckrop_1736: Heat shock protein 60 family chaperone GroEL |
Gene: cur_0394: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| tnp1a |
|
|
|
|
Gene: cg0692: Transposase |
|
|
|
Transposase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |