Regulon of HrcA in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg2516
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Corynebacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -183 Score: 7 Sequence: CTTGCACTCACACCCCTTGAGTGCTAG Position: -148 Score: 5.2 Sequence: TTAGCACTCAACTAATCAGAGTGCCAA Locus tag: cg3011 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	cg3011	groL2	Heat shock protein 60 family chaperone GroEL
Position: -147 Score: 5.9 Sequence: TTAGCACCCTCAACAGTTGAGTGCTGG Locus tag: cg0690 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: cg0691 Name: groL1 Funciton: Heat shock protein 60 family chaperone GroEL Locus tag: cg0692 Name: tnp1a Funciton: Transposase Locus tag: cg0693 Name: groL1 Funciton: Heat shock protein 60 family chaperone GroEL
	cg0690	groS	Heat shock protein 60 family co-chaperone GroES
	cg0691	groL1	Heat shock protein 60 family chaperone GroEL
	cg0692	tnp1a	Transposase
	cg0693	groL1	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD