Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tnp1a gene

Properties
Regulog: HrcA - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium glutamicum ATCC 13032
Position: -147
Score: 5.86435
Sequence: TTAGCACCCTCAACAGTTGAGTGCTGG
Locus tag: cg0690
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: cg0691
Name: groL1
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: cg0692
Name: tnp1a
Funciton: Transposase
Locus tag: cg0693
Name: groL1
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL1-tnp1a-groL1 -147 5.9 TTAGCACCCTCAACAGTTGAGTGCTGG cg0690
© 2009-2020 RegPrecise