Regulon of HrcA in Corynebacterium aurimucosum ATCC 700975

Properties
Regulator type:	Transcription factor
TF locus tag:	cauri_1810
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -184 Score: 5.1 Sequence: CTTGCAGTCGGTAGGCCTGAGTGCCAG Position: -149 Score: 5.2 Sequence: CTAGCACTTCCACATGGCAAGTGCCAG Locus tag: cauri_2263 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	cauri_2263	groL2	Heat shock protein 60 family chaperone GroEL
Position: -144 Score: 5.5 Sequence: CTAGCAGTCGCGAGGGTAGAGTGCTAG Locus tag: cauri_0474 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: cauri_0475 Name: groL1 Funciton: Heat shock protein 60 family chaperone GroEL
	cauri_0474	groS	Heat shock protein 60 family co-chaperone GroES
	cauri_0475	groL1	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD