Regulog PhnF - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - PhnF
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 8 | 2 |
| Rhizobium sp. NGR234 | 8 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 9 | 2 |
| Rhizobium etli CFN 42 | 15 | 2 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 8 | 2 |
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | 4 | 2 |
| Brucella melitensis 16M | 2 | 2 |
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | 9 | 2 |
| Bradyrhizobium japonicum USDA 110 | 9 | 2 |
| Bradyrhizobium sp. BTAi1 | 9 | 2 |
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | 1 | 1 |
| Xanthobacter autotrophicus Py2 | 4 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| phnG |
*
Sinorhizobium meliloti 1021 Site: position = -31 score = 6.20626 sequence = TTGTCTAGATCAATAGACAT Gene: SMb20759: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Rhizobium sp. NGR234 Site: position = -34 score = 6.20626 sequence = TTGTCTAGATCAATAGACAT Gene: NGR_b21010: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -36 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: RL0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Rhizobium etli CFN 42 Site: position = -35 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: RHE_CH00167: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -33 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: Atu0181: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
|
*3
Mesorhizobium loti MAFF303099 Site: position = -44 score = 6.61599 sequence = TTGTCTATATCAATAGACAA Gene: mlr3342: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Gene: mll9155: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Gene: mlr9277: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
|
|
*
Rhodopseudomonas palustris CGA009 Site: position = -39 score = 6.50713 sequence = TTGTCTATTAACATAGACAA Gene: RPA0695: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Bradyrhizobium japonicum USDA 110 Site: position = 6 score = 6.04801 sequence = TTGTCTACTATCATAGACAA Gene: blr1221: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Bradyrhizobium sp. BTAi1 Site: position = -72 score = 6.42903 sequence = TTGTCTATTATCATAGACAA Gene: BBta_5848: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
|
Gene: AZC_3392: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Xanthobacter autotrophicus Py2 Site: position = -104 score = 5.5744 sequence = TTGTCTATTTGTCTAGACTA Gene: Xaut_1316: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
| phnH |
Gene: SMb20760: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: NGR_b21020: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: RL0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: RHE_CH00166: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: Atu0180: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
|
3
Mesorhizobium loti MAFF303099 Gene: mlr3343: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Gene: mll9154: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Gene: mlr9279: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
|
|
Gene: RPA0694: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: blr1222: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: BBta_5847: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
|
Gene: AZC_3393: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: Xaut_1315: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
| phnI |
Gene: SMb20761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: NGR_b21030: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: RL0175: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: RHE_CH00165: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: Atu0179: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
|
3
Mesorhizobium loti MAFF303099 Gene: mlr3344: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Gene: mll9153: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Gene: mlr9280: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
|
|
Gene: RPA0693: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: blr1223: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: BBta_5846: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
|
Gene: AZC_3394: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: Xaut_1314: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
| phnJ |
Gene: SMb20762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: NGR_b21040: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: RL0174: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: RHE_CH00164: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: Atu0178: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
|
3
Mesorhizobium loti MAFF303099 Gene: mlr3346: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Gene: mll9152: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Gene: mlr9282: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
|
|
Gene: RPA0692: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: blr1224: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: BBta_5845: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
|
Gene: AZC_3395: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: Xaut_1313: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
| phnK |
Gene: SMb20763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: NGR_b21050: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: RL0173: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: RHE_CH00163: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: Atu0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
|
4
Mesorhizobium loti MAFF303099 Gene: mlr3347: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: mll9151: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: msr9284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: mlr9283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
|
|
Gene: RPA0691: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: blr1225: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: BBta_5844: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
|
Gene: AZC_3397: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: Xaut_1312: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
| phnL |
Gene: SMb20764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: NGR_b21060: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: RL0172: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: RHE_CH00162: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: Atu0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
|
3
Mesorhizobium loti MAFF303099 Gene: mlr3349: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Gene: mll9150: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Gene: mlr9286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
|
|
Gene: RPA0690: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: blr1226: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: BBta_5843: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
|
Gene: AZC_3398: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: Xaut_1311: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
| phnO |
Gene: SMb20765: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: NGR_b21070: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: RL0171: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: RHE_CH00161: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: Atu0175: Aminoalkylphosphonic acid N-acetyltransferase |
|
2
Mesorhizobium loti MAFF303099 Gene: mlr3351: Aminoalkylphosphonic acid N-acetyltransferase Gene: mll1530: Aminoalkylphosphonic acid N-acetyltransferase |
|
|
Gene: RPA0701: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: blr7948: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: BBta_5859: Aminoalkylphosphonic acid N-acetyltransferase |
|
Gene: AZC_0705: Aminoalkylphosphonic acid N-acetyltransferase |
Gene: Xaut_1753: Aminoalkylphosphonic acid N-acetyltransferase |
Aminoalkylphosphonic acid N-acetyltransferase |
| phnC |
Gene: SMb21177: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: NGR_b13340: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: RL0170: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: RHE_CH00160: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: Atu0174: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: mlr3353: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
|
|
Gene: RPA0700: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: bll7947: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: BBta_5858: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: AZC_1058: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Gene: Xaut_1322: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
| phnD |
Gene: SMb21176: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: NGR_b13330: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: RL0168: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: RHE_CH00159: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: Atu0173: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
|
Gene: mlr3355: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
|
|
Gene: RPA0699: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: bll7946: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: BBta_5857: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
|
Gene: AZC_1057: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Gene: Xaut_1321: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) |
| phnE2 |
Gene: SMb21175: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: NGR_b13320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: RL0167: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: RHE_CH00158: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: Atu0172: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
|
Gene: mlr3356: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
|
|
Gene: RPA0698: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: bll7945: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: BBta_5856: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
|
Gene: AZC_1056: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Gene: Xaut_1320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) |
| phnE |
Gene: SMb21174: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: NGR_b13310: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: RL0166: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: RHE_CH00157: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: Atu0171: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
|
2
Mesorhizobium loti MAFF303099 Gene: mlr3359: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) Gene: mlr3358: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
|
|
Gene: RPA0697: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: bll7944: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: BBta_5855: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
|
Gene: AZC_1055: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Gene: Xaut_1319: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) |
| rcsF |
|
Gene: NGR_b13300: Protein RcsF involved in phosphonates utilization |
Gene: RL0165: Protein RcsF involved in phosphonates utilization |
Gene: RHE_CH00156: Protein RcsF involved in phosphonates utilization |
Gene: Atu0170: Protein RcsF involved in phosphonates utilization |
|
2
Mesorhizobium loti MAFF303099 Gene: mll4975: Protein RcsF involved in phosphonates utilization Gene: mlr9287: Protein RcsF involved in phosphonates utilization |
Gene: BMEI1107: Protein RcsF involved in phosphonates utilization |
|
Gene: RPA0703: Protein RcsF involved in phosphonates utilization |
Gene: blr7950: Protein RcsF involved in phosphonates utilization |
Gene: BBta_5861: Protein RcsF involved in phosphonates utilization |
|
Gene: AZC_0704: Protein RcsF involved in phosphonates utilization |
Gene: Xaut_1754: Protein RcsF involved in phosphonates utilization |
Protein RcsF involved in phosphonates utilization |
| phnM |
Gene: SMb21171: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: NGR_b13290: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: RL0164: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: RHE_CH00155: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: Atu0169: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
|
3
Mesorhizobium loti MAFF303099 Gene: mll4974: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Gene: mlr9276: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Gene: mll9156: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: BMEI1106: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
|
Gene: RPA0689: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: blr1227: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: BBta_5842: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
|
Gene: AZC_3399: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: Xaut_1310: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
| phnN |
Gene: SMb21170: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: NGR_b13280: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: RL0163: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: RHE_CH00154: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: Atu0168: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
|
2
Mesorhizobium loti MAFF303099 Gene: mll4973: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) Gene: mlr9288: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
*
Brucella melitensis 16M Site: position = -136 score = 6.11425 sequence = TTATCTATATAAATAGACAA Gene: BMEI0882: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
|
Gene: RPA0688: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: blr1228: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: BBta_5841: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
|
Gene: AZC_3400: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: Xaut_1309: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
| CRON 2. | ||||||||||||||||
| phnF |
*
Sinorhizobium meliloti 1021 Site: position = -111 score = 6.20963 sequence = ATGTCTATTGATCTAGACAA Gene: SM_b20758: Transcriptional regulator for phosphonate utilization, GntR family |
*
Rhizobium sp. NGR234 Site: position = -73 score = 6.20963 sequence = ATGTCTATTGATCTAGACAA Gene: NGR_b21000: Transcriptional regulator for phosphonate utilization, GntR family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -101 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: RL0178: Transcriptional regulator for phosphonate utilization, GntR family |
*
Rhizobium etli CFN 42 Site: position = -94 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: RHE_CH00168: Transcriptional regulator for phosphonate utilization, GntR family |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -69 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: Atu0182: Transcriptional regulator for phosphonate utilization, GntR family |
|
*
Mesorhizobium loti MAFF303099 Site: position = -96 score = 6.70983 sequence = TTGTCTATTGATATAGACAA Gene: mll3341: Transcriptional regulator for phosphonate utilization, GntR family |
*
Brucella melitensis 16M Site: position = -70 score = 6.59941 sequence = TTGTCTATTTATATAGATAA Gene: BMEI0881: Transcriptional regulator for phosphonate utilization, GntR family |
|
*
Rhodopseudomonas palustris CGA009 Site: position = -92 score = 6.46443 sequence = TTGTCTATGTTAATAGACAA Gene: RPA0696: Transcriptional regulator for phosphonate utilization, GntR family |
*
Bradyrhizobium japonicum USDA 110 Site: position = -88 score = 5.9807 sequence = TTGTCTATGATAGTAGACAA Gene: bll1220: Transcriptional regulator for phosphonate utilization, GntR family |
*
Bradyrhizobium sp. BTAi1 Site: position = -91 score = 6.37142 sequence = TTGTCTATGATAATAGACAA Gene: BBta_5849: Transcriptional regulator for phosphonate utilization, GntR family |
|
*
Azorhizobium caulinodans ORS 571 Site: position = -63 score = 4.56383 sequence = TTGTATAAAAGTCTATACAA Site: position = -55 score = 4.78619 sequence = AAGTCTATACAAATAGGCAA Gene: AZC_3391: Transcriptional regulator for phosphonate utilization, GntR family |
*
Xanthobacter autotrophicus Py2 Site: position = -47 score = 5.46566 sequence = TAGTCTAGACAAATAGACAA Gene: Xaut_1317: Transcriptional regulator for phosphonate utilization, GntR family |
Transcriptional regulator for phosphonate utilization, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |