Statistics of regulated genes

Genome	Genes	Operons
Sinorhizobium meliloti 1021	8	2
Rhizobium sp. NGR234	8	2
Rhizobium leguminosarum bv. viciae 3841	9	2
Rhizobium etli CFN 42	15	2
Agrobacterium tumefaciens str. C58 (Cereon)	8	2
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099	4	2
Brucella melitensis 16M	2	2
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009	9	2
Bradyrhizobium japonicum USDA 110	9	2
Bradyrhizobium sp. BTAi1	9	2
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571	1	1
Xanthobacter autotrophicus Py2	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
phnG	* Sinorhizobium meliloti 1021 Site: position = -31 score = 6.20626 sequence = TTGTCTAGATCAATAGACAT Gene: SMb20759: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Rhizobium sp. NGR234 Site: position = -34 score = 6.20626 sequence = TTGTCTAGATCAATAGACAT Gene: NGR_b21010: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Rhizobium leguminosarum bv. viciae 3841 Site: position = -36 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: RL0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Rhizobium etli CFN 42 Site: position = -35 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: RHE_CH00167: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -33 score = 6.3856 sequence = TTGTCTATATCAATAGACAT Gene: Atu0181: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	Mesorhizobium sp. BNC1	*3 Mesorhizobium loti MAFF303099 Site: position = -44 score = 6.61599 sequence = TTGTCTATATCAATAGACAA Gene: mlr3342: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Gene: mll9155: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Gene: mlr9277: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	Brucella melitensis 16M	Bartonella quintana str. Toulouse	* Rhodopseudomonas palustris CGA009 Site: position = -39 score = 6.50713 sequence = TTGTCTATTAACATAGACAA Gene: RPA0695: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Bradyrhizobium japonicum USDA 110 Site: position = 6 score = 6.04801 sequence = TTGTCTACTATCATAGACAA Gene: blr1221: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Bradyrhizobium sp. BTAi1 Site: position = -72 score = 6.42903 sequence = TTGTCTATTATCATAGACAA Gene: BBta_5848: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3392: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Xanthobacter autotrophicus Py2 Site: position = -104 score = 5.5744 sequence = TTGTCTATTTGTCTAGACTA Gene: Xaut_1316: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH	Sinorhizobium meliloti 1021 Gene: SMb20760: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Rhizobium sp. NGR234 Gene: NGR_b21020: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Rhizobium etli CFN 42 Gene: RHE_CH00166: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0180: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Mesorhizobium sp. BNC1	3 Mesorhizobium loti MAFF303099 Gene: mlr3343: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Gene: mll9154: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Gene: mlr9279: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0694: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Bradyrhizobium japonicum USDA 110 Gene: blr1222: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Bradyrhizobium sp. BTAi1 Gene: BBta_5847: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3393: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Xanthobacter autotrophicus Py2 Gene: Xaut_1315: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI	Sinorhizobium meliloti 1021 Gene: SMb20761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Rhizobium sp. NGR234 Gene: NGR_b21030: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0175: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Rhizobium etli CFN 42 Gene: RHE_CH00165: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0179: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Mesorhizobium sp. BNC1	3 Mesorhizobium loti MAFF303099 Gene: mlr3344: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Gene: mll9153: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Gene: mlr9280: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0693: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Bradyrhizobium japonicum USDA 110 Gene: blr1223: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Bradyrhizobium sp. BTAi1 Gene: BBta_5846: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3394: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Xanthobacter autotrophicus Py2 Gene: Xaut_1314: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ	Sinorhizobium meliloti 1021 Gene: SMb20762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Rhizobium sp. NGR234 Gene: NGR_b21040: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0174: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Rhizobium etli CFN 42 Gene: RHE_CH00164: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0178: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Mesorhizobium sp. BNC1	3 Mesorhizobium loti MAFF303099 Gene: mlr3346: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Gene: mll9152: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Gene: mlr9282: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0692: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Bradyrhizobium japonicum USDA 110 Gene: blr1224: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Bradyrhizobium sp. BTAi1 Gene: BBta_5845: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3395: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Xanthobacter autotrophicus Py2 Gene: Xaut_1313: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK	Sinorhizobium meliloti 1021 Gene: SMb20763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Rhizobium sp. NGR234 Gene: NGR_b21050: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0173: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Rhizobium etli CFN 42 Gene: RHE_CH00163: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Mesorhizobium sp. BNC1	4 Mesorhizobium loti MAFF303099 Gene: mlr3347: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: mll9151: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: msr9284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Gene: mlr9283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0691: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Bradyrhizobium japonicum USDA 110 Gene: blr1225: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Bradyrhizobium sp. BTAi1 Gene: BBta_5844: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3397: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Xanthobacter autotrophicus Py2 Gene: Xaut_1312: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL	Sinorhizobium meliloti 1021 Gene: SMb20764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Rhizobium sp. NGR234 Gene: NGR_b21060: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0172: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Rhizobium etli CFN 42 Gene: RHE_CH00162: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Mesorhizobium sp. BNC1	3 Mesorhizobium loti MAFF303099 Gene: mlr3349: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Gene: mll9150: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Gene: mlr9286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0690: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Bradyrhizobium japonicum USDA 110 Gene: blr1226: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Bradyrhizobium sp. BTAi1 Gene: BBta_5843: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3398: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Xanthobacter autotrophicus Py2 Gene: Xaut_1311: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnO	Sinorhizobium meliloti 1021 Gene: SMb20765: Aminoalkylphosphonic acid N-acetyltransferase	Rhizobium sp. NGR234 Gene: NGR_b21070: Aminoalkylphosphonic acid N-acetyltransferase	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0171: Aminoalkylphosphonic acid N-acetyltransferase	Rhizobium etli CFN 42 Gene: RHE_CH00161: Aminoalkylphosphonic acid N-acetyltransferase	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0175: Aminoalkylphosphonic acid N-acetyltransferase	Mesorhizobium sp. BNC1	2 Mesorhizobium loti MAFF303099 Gene: mlr3351: Aminoalkylphosphonic acid N-acetyltransferase Gene: mll1530: Aminoalkylphosphonic acid N-acetyltransferase	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0701: Aminoalkylphosphonic acid N-acetyltransferase	Bradyrhizobium japonicum USDA 110 Gene: blr7948: Aminoalkylphosphonic acid N-acetyltransferase	Bradyrhizobium sp. BTAi1 Gene: BBta_5859: Aminoalkylphosphonic acid N-acetyltransferase	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_0705: Aminoalkylphosphonic acid N-acetyltransferase	Xanthobacter autotrophicus Py2 Gene: Xaut_1753: Aminoalkylphosphonic acid N-acetyltransferase	Aminoalkylphosphonic acid N-acetyltransferase
phnC	Sinorhizobium meliloti 1021 Gene: SMb21177: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Rhizobium sp. NGR234 Gene: NGR_b13340: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0170: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Rhizobium etli CFN 42 Gene: RHE_CH00160: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0174: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Mesorhizobium sp. BNC1	Mesorhizobium loti MAFF303099 Gene: mlr3353: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0700: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Bradyrhizobium japonicum USDA 110 Gene: bll7947: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Bradyrhizobium sp. BTAi1 Gene: BBta_5858: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_1058: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Xanthobacter autotrophicus Py2 Gene: Xaut_1322: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)	Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnD	Sinorhizobium meliloti 1021 Gene: SMb21176: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Rhizobium sp. NGR234 Gene: NGR_b13330: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0168: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Rhizobium etli CFN 42 Gene: RHE_CH00159: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0173: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Mesorhizobium sp. BNC1	Mesorhizobium loti MAFF303099 Gene: mlr3355: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0699: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Bradyrhizobium japonicum USDA 110 Gene: bll7946: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Bradyrhizobium sp. BTAi1 Gene: BBta_5857: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_1057: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Xanthobacter autotrophicus Py2 Gene: Xaut_1321: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)	Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnE2	Sinorhizobium meliloti 1021 Gene: SMb21175: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Rhizobium sp. NGR234 Gene: NGR_b13320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0167: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Rhizobium etli CFN 42 Gene: RHE_CH00158: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0172: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Mesorhizobium sp. BNC1	Mesorhizobium loti MAFF303099 Gene: mlr3356: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0698: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Bradyrhizobium japonicum USDA 110 Gene: bll7945: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Bradyrhizobium sp. BTAi1 Gene: BBta_5856: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_1056: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Xanthobacter autotrophicus Py2 Gene: Xaut_1320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)	Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
phnE	Sinorhizobium meliloti 1021 Gene: SMb21174: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Rhizobium sp. NGR234 Gene: NGR_b13310: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0166: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Rhizobium etli CFN 42 Gene: RHE_CH00157: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0171: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Mesorhizobium sp. BNC1	2 Mesorhizobium loti MAFF303099 Gene: mlr3359: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) Gene: mlr3358: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Brucella melitensis 16M	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0697: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Bradyrhizobium japonicum USDA 110 Gene: bll7944: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Bradyrhizobium sp. BTAi1 Gene: BBta_5855: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_1055: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Xanthobacter autotrophicus Py2 Gene: Xaut_1319: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)	Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
rcsF	Sinorhizobium meliloti 1021	Rhizobium sp. NGR234 Gene: NGR_b13300: Protein RcsF involved in phosphonates utilization	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0165: Protein RcsF involved in phosphonates utilization	Rhizobium etli CFN 42 Gene: RHE_CH00156: Protein RcsF involved in phosphonates utilization	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0170: Protein RcsF involved in phosphonates utilization	Mesorhizobium sp. BNC1	2 Mesorhizobium loti MAFF303099 Gene: mll4975: Protein RcsF involved in phosphonates utilization Gene: mlr9287: Protein RcsF involved in phosphonates utilization	Brucella melitensis 16M Gene: BMEI1107: Protein RcsF involved in phosphonates utilization	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0703: Protein RcsF involved in phosphonates utilization	Bradyrhizobium japonicum USDA 110 Gene: blr7950: Protein RcsF involved in phosphonates utilization	Bradyrhizobium sp. BTAi1 Gene: BBta_5861: Protein RcsF involved in phosphonates utilization	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_0704: Protein RcsF involved in phosphonates utilization	Xanthobacter autotrophicus Py2 Gene: Xaut_1754: Protein RcsF involved in phosphonates utilization	Protein RcsF involved in phosphonates utilization
phnM	Sinorhizobium meliloti 1021 Gene: SMb21171: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Rhizobium sp. NGR234 Gene: NGR_b13290: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0164: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Rhizobium etli CFN 42 Gene: RHE_CH00155: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0169: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Mesorhizobium sp. BNC1	3 Mesorhizobium loti MAFF303099 Gene: mll4974: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Gene: mlr9276: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Gene: mll9156: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Brucella melitensis 16M Gene: BMEI1106: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0689: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Bradyrhizobium japonicum USDA 110 Gene: blr1227: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Bradyrhizobium sp. BTAi1 Gene: BBta_5842: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3399: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Xanthobacter autotrophicus Py2 Gene: Xaut_1310: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
phnN	Sinorhizobium meliloti 1021 Gene: SMb21170: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Rhizobium sp. NGR234 Gene: NGR_b13280: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Rhizobium leguminosarum bv. viciae 3841 Gene: RL0163: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Rhizobium etli CFN 42 Gene: RHE_CH00154: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu0168: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Mesorhizobium sp. BNC1	2 Mesorhizobium loti MAFF303099 Gene: mll4973: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) Gene: mlr9288: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	* Brucella melitensis 16M Site: position = -136 score = 6.11425 sequence = TTATCTATATAAATAGACAA Gene: BMEI0882: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA0688: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Bradyrhizobium japonicum USDA 110 Gene: blr1228: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Bradyrhizobium sp. BTAi1 Gene: BBta_5841: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Nitrobacter winogradskyi Nb-255	Azorhizobium caulinodans ORS 571 Gene: AZC_3400: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Xanthobacter autotrophicus Py2 Gene: Xaut_1309: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
CRON 2.
phnF	* Sinorhizobium meliloti 1021 Site: position = -111 score = 6.20963 sequence = ATGTCTATTGATCTAGACAA Gene: SM_b20758: Transcriptional regulator for phosphonate utilization, GntR family	* Rhizobium sp. NGR234 Site: position = -73 score = 6.20963 sequence = ATGTCTATTGATCTAGACAA Gene: NGR_b21000: Transcriptional regulator for phosphonate utilization, GntR family	* Rhizobium leguminosarum bv. viciae 3841 Site: position = -101 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: RL0178: Transcriptional regulator for phosphonate utilization, GntR family	* Rhizobium etli CFN 42 Site: position = -94 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: RHE_CH00168: Transcriptional regulator for phosphonate utilization, GntR family	* Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -69 score = 6.43085 sequence = ATGTCTATTGATATAGACAA Gene: Atu0182: Transcriptional regulator for phosphonate utilization, GntR family	Mesorhizobium sp. BNC1	* Mesorhizobium loti MAFF303099 Site: position = -96 score = 6.70983 sequence = TTGTCTATTGATATAGACAA Gene: mll3341: Transcriptional regulator for phosphonate utilization, GntR family	* Brucella melitensis 16M Site: position = -70 score = 6.59941 sequence = TTGTCTATTTATATAGATAA Gene: BMEI0881: Transcriptional regulator for phosphonate utilization, GntR family	Bartonella quintana str. Toulouse	* Rhodopseudomonas palustris CGA009 Site: position = -92 score = 6.46443 sequence = TTGTCTATGTTAATAGACAA Gene: RPA0696: Transcriptional regulator for phosphonate utilization, GntR family	* Bradyrhizobium japonicum USDA 110 Site: position = -88 score = 5.9807 sequence = TTGTCTATGATAGTAGACAA Gene: bll1220: Transcriptional regulator for phosphonate utilization, GntR family	* Bradyrhizobium sp. BTAi1 Site: position = -91 score = 6.37142 sequence = TTGTCTATGATAATAGACAA Gene: BBta_5849: Transcriptional regulator for phosphonate utilization, GntR family	Nitrobacter winogradskyi Nb-255	* Azorhizobium caulinodans ORS 571 Site: position = -63 score = 4.56383 sequence = TTGTATAAAAGTCTATACAA Site: position = -55 score = 4.78619 sequence = AAGTCTATACAAATAGGCAA Gene: AZC_3391: Transcriptional regulator for phosphonate utilization, GntR family	* Xanthobacter autotrophicus Py2 Site: position = -47 score = 5.46566 sequence = TAGTCTAGACAAATAGACAA Gene: Xaut_1317: Transcriptional regulator for phosphonate utilization, GntR family	Transcriptional regulator for phosphonate utilization, GntR family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD