Regulon of PhnF in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_1317
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.5 Sequence: TAGTCTAGACAAATAGACAA Locus tag: Xaut_1317 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family
	Xaut_1317	phnF	Transcriptional regulator for phosphonate utilization, GntR family
Position: -104 Score: 5.6 Sequence: TTGTCTATTTGTCTAGACTA Locus tag: Xaut_1316 Name: phnG Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Locus tag: Xaut_1315 Name: phnH Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Locus tag: Xaut_1314 Name: phnI Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
	Xaut_1316	phnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
	Xaut_1315	phnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
	Xaut_1314	phnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD