Regulon of PhnF in Brucella melitensis 16M

Properties
Regulator type:	Transcription factor
TF locus tag:	BMEI0881
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.6 Sequence: TTGTCTATTTATATAGATAA Locus tag: BMEI0881 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family
	BMEI0881	phnF	Transcriptional regulator for phosphonate utilization, GntR family
Position: -136 Score: 6.1 Sequence: TTATCTATATAAATAGACAA Locus tag: BMEI0882 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
	BMEI0882	phnN	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD