Regulon of PhnF in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll3341
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.6 Sequence: TTGTCTATATCAATAGACAA Locus tag: mlr3342 Name: phnG Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Locus tag: mlr3343 Name: phnH Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Locus tag: mlr3344 Name: phnI Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
	mlr3342	phnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
	mlr3343	phnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
	mlr3344	phnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Position: -96 Score: 6.7 Sequence: TTGTCTATTGATATAGACAA Locus tag: mll3341 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family
	mll3341	phnF	Transcriptional regulator for phosphonate utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD