Regulon of PhnF in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_3391
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Rhizobiales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 4.6 Sequence: TTGTATAAAAGTCTATACAA Position: -55 Score: 4.8 Sequence: AAGTCTATACAAATAGGCAA Locus tag: AZC_3391 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family
	AZC_3391	phnF	Transcriptional regulator for phosphonate utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD