Regulog OhcR - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | Fis |
| Regulation mode: | |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Fis
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | 2 | 1 |
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | 2 | 1 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | 2 | 1 |
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 4 | 1 |
| Desulfovibrio vulgaris Hildenborough | 3 | 1 |
| Desulfovibrio vulgaris str. Miyazaki F | 3 | 1 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| ohcB |
Gene: Dret_0164: iron-sulfur cluster-binding protein |
Gene: Dbac_1361: iron-sulfur cluster-binding protein |
*
Desulfovibrio desulfuricans G20 Site: position = -178 score = 4.58814 sequence = CCATATGATTAGACATTATC Site: position = -190 score = 4.73159 sequence = ACATATGTCTAACCATATGA Gene: Dde_0657: iron-sulfur cluster-binding protein |
2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_0544: iron-sulfur cluster-binding protein Gene: Ddes_2065: iron-sulfur cluster-binding protein |
Gene: DMR_38630: iron-sulfur cluster-binding protein |
Gene: DESPIG_02228: iron-sulfur cluster-binding protein |
*
Desulfovibrio salexigens DSM 2638 Site: position = -201 score = 5.3347 sequence = ACATGTGTTTAATCATGTGT Gene: Desal_0829: iron-sulfur cluster-binding protein |
*
Desulfovibrio vulgaris Hildenborough Site: position = -186 score = 4.93319 sequence = CATCATGATGCGTCATGTGC Site: position = -210 score = 4.35274 sequence = CCAGATGATGCATCGATTGA Gene: DVU3143: iron-sulfur cluster-binding protein |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -204 score = 5.37424 sequence = CCATATGTCGCATCATATGC Site: position = -235 score = 4.77053 sequence = CAGCATGGCGCAACATGTGC Gene: DvMF_1693: iron-sulfur cluster-binding protein |
|
iron-sulfur cluster-binding protein |
| Desal_0830 |
Gene: Dret_0165: iron-sulfur cluster-binding protein |
Gene: Dbac_1360: iron-sulfur cluster-binding protein |
Gene: Dde_0656: iron-sulfur cluster-binding protein |
Gene: Ddes_2066: iron-sulfur cluster-binding protein |
Gene: DMR_38620: iron-sulfur cluster-binding protein |
Gene: DESPIG_02229: iron-sulfur cluster-binding protein |
Gene: Desal_0830: iron-sulfur cluster-binding protein |
|
|
|
iron-sulfur cluster-binding protein |
| ohcA |
*
Desulfohalobium retbaense DSM 5692 Site: position = -343 score = 4.98123 sequence = CACAATGTTTAAACATGTGT Site: position = -331 score = 4.56528 sequence = ACATGTGTTTAAACACCCTG Gene: Dret_0167: cytochrome c family protein |
Gene: Dbac_1392: cytochrome c family protein |
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -228 score = 4.44998 sequence = GCACATGTCTAAGCAAGTGT Gene: DMR_33620: cytochrome c family protein |
|
Gene: Desal_0831: cytochrome c family protein |
Gene: DVU3144: cytochrome c family protein |
Gene: DvMF_1694: cytochrome c family protein |
|
cytochrome c family protein |
| ohcC |
Gene: Dret_0166: Cytochrome B561 |
Gene: Dbac_1393: Cytochrome B561 |
|
|
Gene: DMR_33610: Cytochrome B561 |
|
Gene: Desal_0832: Cytochrome B561 |
Gene: DVU3145: Cytochrome B561 |
Gene: DvMF_1695: Cytochrome B561 |
|
Cytochrome B561 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |