Regulon of OhcR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_0828
Regulator family:	Fis
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	OhcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -201 Score: 5.3 Sequence: ACATGTGTTTAATCATGTGT Locus tag: Desal_0829 Name: null Funciton: iron-sulfur cluster-binding protein Locus tag: Desal_0830 Name: Desal_0830 Funciton: iron-sulfur cluster-binding protein Locus tag: Desal_0831 Name: null Funciton: cytochrome c family protein Locus tag: Desal_0832 Name: ohcC Funciton: Cytochrome B561
	Desal_0829		iron-sulfur cluster-binding protein
	Desal_0830	Desal_0830	iron-sulfur cluster-binding protein
	Desal_0831		cytochrome c family protein
	Desal_0832	ohcC	Cytochrome B561

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD