Regulon of OhcR in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_0659
Regulator family:	Fis
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	OhcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 4.7 Sequence: ACATATGTCTAACCATATGA Position: -178 Score: 4.6 Sequence: CCATATGATTAGACATTATC Locus tag: Dde_0657 Name: null Funciton: iron-sulfur cluster-binding protein Locus tag: Dde_0656 Name: Desal_0830 Funciton: iron-sulfur cluster-binding protein
	Dde_0657		iron-sulfur cluster-binding protein
	Dde_0656	Desal_0830	iron-sulfur cluster-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD