Regulon of OhcR in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_1692
Regulator family:	Fis
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	OhcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -235 Score: 4.8 Sequence: CAGCATGGCGCAACATGTGC Position: -204 Score: 5.4 Sequence: CCATATGTCGCATCATATGC Locus tag: DvMF_1693 Name: null Funciton: iron-sulfur cluster-binding protein Locus tag: DvMF_1694 Name: null Funciton: cytochrome c family protein Locus tag: DvMF_1695 Name: ohcC Funciton: Cytochrome B561
	DvMF_1693		iron-sulfur cluster-binding protein
	DvMF_1694		cytochrome c family protein
	DvMF_1695	ohcC	Cytochrome B561

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD