Regulon of OhcR in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_0168
Regulator family:	Fis
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	OhcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Fis
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -343 Score: 5 Sequence: CACAATGTTTAAACATGTGT Position: -331 Score: 4.6 Sequence: ACATGTGTTTAAACACCCTG Locus tag: Dret_0167 Name: null Funciton: cytochrome c family protein Locus tag: Dret_0166 Name: ohcC Funciton: Cytochrome B561
	Dret_0167		cytochrome c family protein
	Dret_0166	ohcC	Cytochrome B561

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD