Regulog LexA - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 9 | 8 |
| Psychromonas sp. CNPT3 | 13 | 11 |
| Moritella sp. PE36 | 13 | 12 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 13 | 11 |
| Aeromonas salmonicida subsp. salmonicida A449 | 12 | 10 |
| Tolumonas auensis DSM 9187 | 10 | 8 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| ruvA |
*
Psychromonas ingrahamii 37 Site: position = -64 score = 5.31575 sequence = TACTGGATATTTACTCAGTT Gene: Ping_0718: Holliday junction DNA helicase RuvA |
*
Psychromonas sp. CNPT3 Site: position = -64 score = 5.19926 sequence = CACTGGATATAAAGTCAGTT Gene: PCNPT3_11040: Holliday junction DNA helicase RuvA |
*
Moritella sp. PE36 Site: position = -74 score = 5.30012 sequence = ATCTGGATATTTAACCAGTA Gene: PE36_02589: Holliday junction DNA helicase RuvA |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -74 score = 5.11309 sequence = TGCTGGATACTTATCCAGTT Gene: AHA_3648: Holliday junction DNA helicase RuvA |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -74 score = 5.11309 sequence = TGCTGGATACTTATCCAGTT Gene: ASA_0735: Holliday junction DNA helicase RuvA |
*
Tolumonas auensis DSM 9187 Site: position = -63 score = 5.21364 sequence = AACTGGATGTTCATCCAGTT Gene: Tola_2712: Holliday junction DNA helicase RuvA |
Holliday junction DNA helicase RuvA |
| ruvB |
Gene: Ping_0719: Holliday junction DNA helicase RuvB |
Gene: PCNPT3_11035: Holliday junction DNA helicase RuvB |
Gene: PE36_02584: Holliday junction DNA helicase RuvB |
Gene: AHA_3647: Holliday junction DNA helicase RuvB |
Gene: ASA_0736: Holliday junction DNA helicase RuvB |
Gene: Tola_2711: Holliday junction DNA helicase RuvB |
Holliday junction DNA helicase RuvB |
| CRON 2. | |||||||
| lexA |
*
Psychromonas ingrahamii 37 Site: position = -43 score = 4.90492 sequence = CACTGTTCATGTTTACAGTT Site: position = -58 score = 4.56693 sequence = CCATGTATGAATATACACTG Gene: Ping_0108: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Psychromonas sp. CNPT3 Site: position = -37 score = 5.57942 sequence = CACTGTCTATATTAACAGTT Site: position = -52 score = 4.5492 sequence = CCATGTATAGATATACACTG Gene: PCNPT3_02010: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Moritella sp. PE36 Site: position = -30 score = 5.90841 sequence = AACTGTATATAAAACCAGTT Site: position = -50 score = 5.19063 sequence = TACTGTATATAATTACAAGA Gene: PE36_16374: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -29 score = 5.28587 sequence = TGCTGTATAAAAAGACAGGT Site: position = -49 score = 5.29087 sequence = CACTGTATATACTGCCAGTG Gene: AHA_0183: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -29 score = 5.46119 sequence = TGCTGTATAAAAAAACAGGT Site: position = -49 score = 5.29087 sequence = CACTGTATATACTGCCAGTG Gene: ASA_4206: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Tolumonas auensis DSM 9187 Site: position = -27 score = 5.00638 sequence = ATCTGTATAAAAACACAGGC Site: position = -47 score = 5.6257 sequence = AACTGTATATACTCACAGTT Gene: Tola_0146: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| CRON 3. | |||||||
| recN |
*
Psychromonas ingrahamii 37 Site: position = -48 score = 5.22 sequence = GACTGTGCAAATAAACAGTG Site: position = -71 score = 6.08937 sequence = TACTGTTTAAAAAAACAGTA Gene: Ping_0914: DNA repair protein RecN |
*
Psychromonas sp. CNPT3 Site: position = -33 score = 5.59879 sequence = CACTGTTCATACAAACAGTA Site: position = -56 score = 6.08937 sequence = TACTGTTTAAAAAAACAGTA Gene: PCNPT3_10460: DNA repair protein RecN |
*
Moritella sp. PE36 Site: position = -25 score = 4.17354 sequence = GGCTGATAAAATAAACAGGA Site: position = -42 score = 5.53767 sequence = TACTGTATATAAAACCAGGC Gene: PE36_05748: DNA repair protein RecN |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -45 score = 5.76992 sequence = TACTGGATACATACACAGTA Site: position = -67 score = 5.5647 sequence = TACTGTATGGAAAACCAGTA Gene: AHA_2986: DNA repair protein RecN |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -45 score = 5.53198 sequence = TACTGGATGCATACACAGTA Site: position = -67 score = 5.5647 sequence = TACTGTATGGAAAACCAGTA Gene: ASA_2999: DNA repair protein RecN |
*
Tolumonas auensis DSM 9187 Site: position = -61 score = 5.91132 sequence = TACTGTATCTATATACAGTA Site: position = -101 score = 5.70962 sequence = AACTGTTTTAATATACAGTA Gene: Tola_2260: DNA repair protein RecN |
DNA repair protein RecN |
| CRON 4. | |||||||
| topB |
*
Psychromonas ingrahamii 37 Site: position = -34 score = 5.83704 sequence = TACTGTGTAAAAAAACAGTT Gene: Ping_2461: DNA topoisomerase III (EC 5.99.1.2) |
*
Psychromonas sp. CNPT3 Site: position = -76 score = 6.04893 sequence = TACTGTCTATATAAACAGTT Gene: PCNPT3_08640: DNA topoisomerase III (EC 5.99.1.2) |
*
Moritella sp. PE36 Site: position = -36 score = 5.53459 sequence = AACTGTTTATTCATACAGTC Gene: PE36_16620: DNA topoisomerase III (EC 5.99.1.2) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -34 score = 5.77251 sequence = TACTGTTCACATATACAGTA Gene: AHA_4047: DNA topoisomerase III (EC 5.99.1.2) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -36 score = 5.53457 sequence = TACTGTTCGCATATACAGTA Gene: ASA_0267: DNA topoisomerase III (EC 5.99.1.2) |
Gene: Tola_2404: DNA topoisomerase III (EC 5.99.1.2) |
DNA topoisomerase III (EC 5.99.1.2) |
| CRON 5. | |||||||
| dinB |
Gene: Ping_1342: DNA polymerase IV (EC 2.7.7.7) |
*
Psychromonas sp. CNPT3 Site: position = -55 score = 5.96044 sequence = TACTGTATATATAATCAGTT Gene: PCNPT3_05579: DNA polymerase IV (EC 2.7.7.7) |
*
Moritella sp. PE36 Site: position = -50 score = 4.83216 sequence = AACTGGTCTTTTATACAGTG Gene: PE36_21990: DNA polymerase IV (EC 2.7.7.7) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -22 score = 4.92002 sequence = ACCTGTTTATTCGTACAGTG Gene: AHA_1145: DNA polymerase IV (EC 2.7.7.7) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = 11 score = 5.22418 sequence = AACTGTTTATTCGTACAGTG Gene: ASA_3190: DNA polymerase IV (EC 2.7.7.7) |
*
Tolumonas auensis DSM 9187 Site: position = -25 score = 5.48396 sequence = TACTGTGTATTTGTACAGTA Gene: Tola_0804: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
| CRON 6. | |||||||
| uvrA |
Gene: Ping_0369: Excinuclease ABC subunit A |
*
Psychromonas sp. CNPT3 Site: position = -37 score = 5.38456 sequence = TACTGTTTTAATTAACAGTG Gene: PCNPT3_12972: Excinuclease ABC subunit A |
Gene: PE36_14400: Excinuclease ABC subunit A |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -72 score = 5.18796 sequence = ACCTGTCTATTCATCCAGTA Gene: AHA_3955: Excinuclease ABC subunit A |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -72 score = 5.18796 sequence = ACCTGTCTATTCATCCAGTA Gene: ASA_3999: Excinuclease ABC subunit A |
*
Tolumonas auensis DSM 9187 Site: position = -68 score = 5.21784 sequence = TACTGGCTATTCATCCAGTG Gene: Tola_0231: Excinuclease ABC subunit A |
Excinuclease ABC subunit A |
| CRON 7. | |||||||
| yebG |
*
Psychromonas ingrahamii 37 Site: position = -95 score = 5.45973 sequence = TACTGTATAAAAATACATGA Gene: Ping_2220: SOS regulon DNA damage-inducible protein |
*
Psychromonas sp. CNPT3 Site: position = 74 score = 5.30566 sequence = TACTGTATATAAAACCATGA Gene: PCNPT3_06468: SOS regulon DNA damage-inducible protein |
*
Moritella sp. PE36 Site: position = -38 score = 4.75959 sequence = CACTGTCATAATATACAGTG Gene: PE36_11847: SOS regulon DNA damage-inducible protein |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -53 score = 4.67665 sequence = TACTGTATATCCATACATAT Gene: AHA_2277: SOS regulon DNA damage-inducible protein |
|
|
SOS regulon DNA damage-inducible protein |
| CRON 8. | |||||||
| recG |
Gene: Ping_3492: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
Gene: PCNPT3_02260: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Moritella sp. PE36 Site: position = -35 score = 5.37046 sequence = ATATGTTTATATATACAGTA Gene: PE36_16064: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -35 score = 5.01718 sequence = ATCTGGACATATTTACAGTG Gene: AHA_0284: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -35 score = 4.32831 sequence = ATTTGGACATATTTACAGTG Gene: ASA_4113: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
*
Tolumonas auensis DSM 9187 Site: position = -32 score = 5.21423 sequence = ATCTGGATAAATTCACAGTA Gene: Tola_0241: ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
ATP-dependent DNA helicase RecG (EC 3.6.1.-) |
| CRON 9. | |||||||
| uvrD |
*
Psychromonas ingrahamii 37 Site: position = -28 score = 5.5474 sequence = TACTGAATAAATAAACAGGT Gene: Ping_0008: ATP-dependent DNA helicase II |
*
Psychromonas sp. CNPT3 Site: position = -28 score = 5.23069 sequence = TACTGATTAAATAGACAGGT Gene: PCNPT3_01364: ATP-dependent DNA helicase II |
*
Moritella sp. PE36 Site: position = -35 score = 5.55399 sequence = TACTGATTAAATATACAGTC Gene: PE36_15844: ATP-dependent DNA helicase II |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -26 score = 5.38669 sequence = GCCTGTATAAATAAACAGGA Gene: AHA_0220: ATP-dependent DNA helicase II |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -26 score = 5.38669 sequence = GCCTGTATAAATAAACAGGA Gene: ASA_4174: ATP-dependent DNA helicase II |
*
Tolumonas auensis DSM 9187 Site: position = -58 score = 4.59852 sequence = TACTGTATAAAAACCCACCC Gene: Tola_0349: ATP-dependent DNA helicase II |
ATP-dependent DNA helicase II |
| CRON 10. | |||||||
| polB |
Gene: Ping_1857: DNA polymerase II (EC 2.7.7.7) |
Gene: PCNPT3_08290: DNA polymerase II (EC 2.7.7.7) |
*
Moritella sp. PE36 Site: position = -45 score = 4.82065 sequence = TGCTGTACACTTAACCAGTC Gene: PE36_19455: DNA polymerase II (EC 2.7.7.7) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -52 score = 4.79148 sequence = CACTGTATGAACGTACAATA Gene: AHA_2107: DNA polymerase II (EC 2.7.7.7) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -73 score = 4.79148 sequence = CACTGTATGAACGTACAATA Gene: ASA_2190: DNA polymerase II (EC 2.7.7.7) |
Gene: Tola_2147: DNA polymerase II (EC 2.7.7.7) |
DNA polymerase II (EC 2.7.7.7) |
| CRON 11. | |||||||
| recX |
Gene: Ping_2629: Regulatory protein RecX |
*
Psychromonas sp. CNPT3 Site: position = -43 score = 5.57814 sequence = TACTGTTCATAATAACAGTA Gene: PCNPT3_07113: Regulatory protein RecX |
Gene: PE36_08961: Regulatory protein RecX |
Gene: AHA_3715: Regulatory protein RecX |
Gene: ASA_3810: Regulatory protein RecX |
Gene: Tola_2730: Regulatory protein RecX |
Regulatory protein RecX |
| radA |
Gene: Ping_2630: DNA repair protein RadA |
Gene: PCNPT3_07108: DNA repair protein RadA |
*
Moritella sp. PE36 Site: position = -65 score = 5.4325 sequence = AACTGTATATACATCCAGAT Gene: PE36_11322: DNA repair protein RadA |
Gene: AHA_3681: DNA repair protein RadA |
Gene: ASA_3647: DNA repair protein RadA |
Gene: Tola_2595: DNA repair protein RadA |
DNA repair protein RadA |
| recA |
*
Psychromonas ingrahamii 37 Site: position = -55 score = 5.16122 sequence = TACTGAGTGCATATACAGTT Site: position = -89 score = 5.50722 sequence = TACTGTGTAAATCAACAGTA Gene: Ping_3381: Recombinase A |
*
Psychromonas sp. CNPT3 Site: position = -65 score = 5.57621 sequence = TACTGTATGAATAGTCAGTA Site: position = -45 score = 5.41566 sequence = AACTGATCATATAAACAGTA Gene: PCNPT3_13378: Recombinase A |
*
Moritella sp. PE36 Site: position = -68 score = 5.53995 sequence = TACTGTATGAACGAACAGTA Gene: PE36_23016: Recombinase A |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -68 score = 5.94892 sequence = TACTGTATGAATAGACAGTA Gene: AHA_3716: Recombinase A |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -69 score = 5.94892 sequence = TACTGTATGAATAGACAGTA Gene: ASA_3809: Recombinase A |
*
Tolumonas auensis DSM 9187 Site: position = -64 score = 5.86857 sequence = TACTGTATGGATAAACAGTA Gene: Tola_2731: Recombinase A |
Recombinase A |
| CRON 12. | |||||||
| SSF52540 |
*
Psychromonas ingrahamii 37 Site: position = -26 score = 4.4664 sequence = CAGTGTTTTTAAATACAGGT Site: position = -41 score = 4.83322 sequence = TACTGTTGTTTTATACAGTG Gene: Ping_2235: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
*
Psychromonas sp. CNPT3 Site: position = -43 score = 5.1382 sequence = TACTGTTAACTTATACAGTG Site: position = -28 score = 4.02912 sequence = CAGTGGTTTTATTTACAGGG Gene: PCNPT3_06983: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
*
Moritella sp. PE36 Site: position = -22 score = 4.68812 sequence = CACTGGATATGCAAACAGGC Site: position = -37 score = 5.39567 sequence = TACTGTATGTATAACCACTG Gene: PE36_14089: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
|
|
|
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |