Regulon of LexA in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_0108
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	9
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 77 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.3 Sequence: TACTGGATATTTACTCAGTT Locus tag: Ping_0718 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: Ping_0719 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	Ping_0718	ruvA	Holliday junction DNA helicase RuvA
	Ping_0719	ruvB	Holliday junction DNA helicase RuvB
Position: -58 Score: 4.6 Sequence: CCATGTATGAATATACACTG Position: -43 Score: 4.9 Sequence: CACTGTTCATGTTTACAGTT Locus tag: Ping_0108 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Ping_0108	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -41 Score: 4.8 Sequence: TACTGTTGTTTTATACAGTG Position: -26 Score: 4.5 Sequence: CAGTGTTTTTAAATACAGGT Locus tag: Ping_2235 Name: SSF52540 Funciton: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
	Ping_2235	SSF52540	hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
Position: -34 Score: 5.8 Sequence: TACTGTGTAAAAAAACAGTT Locus tag: Ping_2461 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Ping_2461	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -89 Score: 5.5 Sequence: TACTGTGTAAATCAACAGTA Position: -55 Score: 5.2 Sequence: TACTGAGTGCATATACAGTT Locus tag: Ping_3381 Name: recA Funciton: Recombinase A
	Ping_3381	recA	Recombinase A
Position: -95 Score: 5.5 Sequence: TACTGTATAAAAATACATGA Locus tag: Ping_2220 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Ping_2220	yebG	SOS regulon DNA damage-inducible protein
Position: -71 Score: 6.1 Sequence: TACTGTTTAAAAAAACAGTA Position: -48 Score: 5.2 Sequence: GACTGTGCAAATAAACAGTG Locus tag: Ping_0914 Name: recN Funciton: DNA repair protein RecN
	Ping_0914	recN	DNA repair protein RecN
Position: -28 Score: 5.5 Sequence: TACTGAATAAATAAACAGGT Locus tag: Ping_0008 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Ping_0008	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD