Regulon of LexA in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_16374
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	13
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 77 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.2 Sequence: TACTGTATATAATTACAAGA Position: -30 Score: 5.9 Sequence: AACTGTATATAAAACCAGTT Locus tag: PE36_16374 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	PE36_16374	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -50 Score: 4.8 Sequence: AACTGGTCTTTTATACAGTG Locus tag: PE36_21990 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	PE36_21990	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -35 Score: 5.4 Sequence: ATATGTTTATATATACAGTA Locus tag: PE36_16064 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	PE36_16064	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -65 Score: 5.4 Sequence: AACTGTATATACATCCAGAT Locus tag: PE36_11322 Name: radA Funciton: DNA repair protein RadA
	PE36_11322	radA	DNA repair protein RadA
Position: -68 Score: 5.5 Sequence: TACTGTATGAACGAACAGTA Locus tag: PE36_23016 Name: recA Funciton: Recombinase A
	PE36_23016	recA	Recombinase A
Position: -36 Score: 5.5 Sequence: AACTGTTTATTCATACAGTC Locus tag: PE36_16620 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	PE36_16620	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -74 Score: 5.3 Sequence: ATCTGGATATTTAACCAGTA Locus tag: PE36_02589 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: PE36_02584 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	PE36_02589	ruvA	Holliday junction DNA helicase RuvA
	PE36_02584	ruvB	Holliday junction DNA helicase RuvB
Position: -38 Score: 4.8 Sequence: CACTGTCATAATATACAGTG Locus tag: PE36_11847 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	PE36_11847	yebG	SOS regulon DNA damage-inducible protein
Position: -35 Score: 5.6 Sequence: TACTGATTAAATATACAGTC Locus tag: PE36_15844 Name: uvrD Funciton: ATP-dependent DNA helicase II
	PE36_15844	uvrD	ATP-dependent DNA helicase II
Position: -42 Score: 5.5 Sequence: TACTGTATATAAAACCAGGC Position: -25 Score: 4.2 Sequence: GGCTGATAAAATAAACAGGA Locus tag: PE36_05748 Name: recN Funciton: DNA repair protein RecN
	PE36_05748	recN	DNA repair protein RecN
Position: -45 Score: 4.8 Sequence: TGCTGTACACTTAACCAGTC Locus tag: PE36_19455 Name: polB Funciton: DNA polymerase II (EC 2.7.7.7)
	PE36_19455	polB	DNA polymerase II (EC 2.7.7.7)
Position: -37 Score: 5.4 Sequence: TACTGTATGTATAACCACTG Position: -22 Score: 4.7 Sequence: CACTGGATATGCAAACAGGC Locus tag: PE36_14089 Name: SSF52540 Funciton: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
	PE36_14089	SSF52540	hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Moritella sp. PE36

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --