Regulon of LexA in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_4206
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	12
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 77 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.9 Sequence: TACTGTATGAATAGACAGTA Locus tag: ASA_3809 Name: recA Funciton: Recombinase A Locus tag: ASA_3810 Name: recX Funciton: Regulatory protein RecX
	ASA_3809	recA	Recombinase A
	ASA_3810	recX	Regulatory protein RecX
Position: -35 Score: 4.3 Sequence: ATTTGGACATATTTACAGTG Locus tag: ASA_4113 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	ASA_4113	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -36 Score: 5.5 Sequence: TACTGTTCGCATATACAGTA Locus tag: ASA_0267 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	ASA_0267	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -73 Score: 4.8 Sequence: CACTGTATGAACGTACAATA Locus tag: ASA_2190 Name: polB Funciton: DNA polymerase II (EC 2.7.7.7)
	ASA_2190	polB	DNA polymerase II (EC 2.7.7.7)
Position: -74 Score: 5.1 Sequence: TGCTGGATACTTATCCAGTT Locus tag: ASA_0735 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: ASA_0736 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	ASA_0735	ruvA	Holliday junction DNA helicase RuvA
	ASA_0736	ruvB	Holliday junction DNA helicase RuvB
Position: -67 Score: 5.6 Sequence: TACTGTATGGAAAACCAGTA Position: -45 Score: 5.5 Sequence: TACTGGATGCATACACAGTA Locus tag: ASA_2999 Name: recN Funciton: DNA repair protein RecN
	ASA_2999	recN	DNA repair protein RecN
Position: -49 Score: 5.3 Sequence: CACTGTATATACTGCCAGTG Position: -29 Score: 5.5 Sequence: TGCTGTATAAAAAAACAGGT Locus tag: ASA_4206 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	ASA_4206	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -72 Score: 5.2 Sequence: ACCTGTCTATTCATCCAGTA Locus tag: ASA_3999 Name: uvrA Funciton: Excinuclease ABC subunit A
	ASA_3999	uvrA	Excinuclease ABC subunit A
Position: 11 Score: 5.2 Sequence: AACTGTTTATTCGTACAGTG Locus tag: ASA_3190 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	ASA_3190	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -26 Score: 5.4 Sequence: GCCTGTATAAATAAACAGGA Locus tag: ASA_4174 Name: uvrD Funciton: ATP-dependent DNA helicase II
	ASA_4174	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Aeromonas salmonicida subsp. salmonicida A449

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --