Regulog ModE - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Burkholderia
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | 3 | 1 |
| Burkholderia mallei ATCC 23344 | 3 | 1 |
| Burkholderia sp. 383 | 3 | 1 |
| Burkholderia cepacia AMMD | 3 | 1 |
| Burkholderia vietnamiensis G4 | 3 | 1 |
| Burkholderia glumae BGR1 | ||
| Burkholderia xenovorans LB400 | 6 | 2 |
| Burkholderia phymatum STM815 | 3 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| modA |
*
Burkholderia pseudomallei K96243 Site: position = -58 score = 5.67795 sequence = CGTTATAACCTCGCGTATATTACG Gene: BPSS1786: Molybdate ABC transporter, substrate-binding protein |
*
Burkholderia mallei ATCC 23344 Site: position = -58 score = 5.67795 sequence = CGTTATAACCTCGCGTATATTACG Gene: BMAA0299: Molybdate ABC transporter, substrate-binding protein |
*
Burkholderia sp. 383 Site: position = 17 score = 6.17954 sequence = CGTTATAACCCGCCCTATATTACG Gene: Bcep18194_B2236: Molybdate ABC transporter, substrate-binding protein |
*
Burkholderia cepacia AMMD Site: position = -57 score = 5.94973 sequence = CGTTATAACCTCCCCTATATTACG Gene: Bamb_3228: Molybdate ABC transporter, substrate-binding protein |
*2
Burkholderia vietnamiensis G4 Gene: Bcep1808_6031: Molybdate ABC transporter, substrate-binding protein Site: position = -57 score = 6.17954 sequence = CGTTATAACCGGCGCTATATTACG Gene: Bcep1808_4236: Molybdate ABC transporter, substrate-binding protein |
|
*2
Burkholderia xenovorans LB400 Site: position = -72 score = 5.78142 sequence = CGTTATAACCTTTCATATATTACG Gene: Bxe_B2848: Molybdate ABC transporter, substrate-binding protein Gene: Bxe_B1480: Molybdate ABC transporter, substrate-binding protein |
*
Burkholderia phymatum STM815 Site: position = -67 score = 5.28571 sequence = CGCTGTAACCAGACATATATTACG Gene: Bphy_4405: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: BPSS1787: Molybdate ABC transporter, permease protein |
Gene: BMAA0298: Molybdate ABC transporter, permease protein |
Gene: Bcep18194_B2237: Molybdate ABC transporter, permease protein |
Gene: Bamb_3227: Molybdate ABC transporter, permease protein |
2
Burkholderia vietnamiensis G4 Gene: Bcep1808_4235: Molybdate ABC transporter, permease protein Gene: Bcep1808_6030: Molybdate ABC transporter, permease protein |
|
*2
Burkholderia xenovorans LB400 Gene: Bxe_B2849: Molybdate ABC transporter, permease protein Site: position = -37 score = 5.10238 sequence = CGTTACGTCGTTCATTTCACAACG Gene: Bxe_B1479: Molybdate ABC transporter, permease protein |
Gene: Bphy_4404: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: BPSS1788: Molybdate ABC transporter, ATP-binding protein |
Gene: BMAA0297: Molybdate ABC transporter, ATP-binding protein |
Gene: Bcep18194_B2238: Molybdate ABC transporter, ATP-binding protein |
Gene: Bamb_3226: Molybdate ABC transporter, ATP-binding protein |
2
Burkholderia vietnamiensis G4 Gene: Bcep1808_4234: Molybdate ABC transporter, ATP-binding protein Gene: Bcep1808_6032: Molybdate ABC transporter, ATP-binding protein |
|
2
Burkholderia xenovorans LB400 Gene: Bxe_B2850: Molybdate ABC transporter, ATP-binding protein Gene: Bxe_B1481: Molybdate ABC transporter, ATP-binding protein |
Gene: Bphy_4403: Molybdate ABC transporter, ATP-binding protein |
Molybdate ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |