Orthologous regulated operons containing modC gene

Properties
Regulog:	ModE - Burkholderia
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/beta

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia cepacia AMMD
Position: -57 Score: 5.94973 Sequence: CGTTATAACCTCCCCTATATTACG Locus tag: Bamb_3228 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bamb_3227 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bamb_3226 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-57	5.9	CGTTATAACCTCCCCTATATTACG	Bamb_3228
Burkholderia mallei ATCC 23344
Position: -58 Score: 5.67795 Sequence: CGTTATAACCTCGCGTATATTACG Locus tag: BMAA0299 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: BMAA0298 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: BMAA0297 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-58	5.7	CGTTATAACCTCGCGTATATTACG	BMAA0299
Burkholderia phymatum STM815
Position: -67 Score: 5.28571 Sequence: CGCTGTAACCAGACATATATTACG Locus tag: Bphy_4405 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bphy_4404 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bphy_4403 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-67	5.3	CGCTGTAACCAGACATATATTACG	Bphy_4405
Burkholderia pseudomallei K96243
Position: -58 Score: 5.67795 Sequence: CGTTATAACCTCGCGTATATTACG Locus tag: BPSS1786 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: BPSS1787 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: BPSS1788 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-58	5.7	CGTTATAACCTCGCGTATATTACG	BPSS1786
Burkholderia sp. 383
Position: 17 Score: 6.17954 Sequence: CGTTATAACCCGCCCTATATTACG Locus tag: Bcep18194_B2236 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep18194_B2237 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bcep18194_B2238 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	17	6.2	CGTTATAACCCGCCCTATATTACG	Bcep18194_B2236
Burkholderia vietnamiensis G4
Position: -57 Score: 6.17954 Sequence: CGTTATAACCGGCGCTATATTACG Locus tag: Bcep1808_4236 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_4235 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bcep1808_4234 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-57	6.2	CGTTATAACCGGCGCTATATTACG	Bcep1808_4236
Burkholderia xenovorans LB400
Position: -37 Score: 5.10238 Sequence: CGTTACGTCGTTCATTTCACAACG Locus tag: Bxe_B1479 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bxe_B1480 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bxe_B1481 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modB-modA-modC	-37	5.1	CGTTACGTCGTTCATTTCACAACG	Bxe_B1479

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing modC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --