Regulon of ModE in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B2239
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 17 Score: 6.2 Sequence: CGTTATAACCCGCCCTATATTACG Locus tag: Bcep18194_B2236 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep18194_B2237 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bcep18194_B2238 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Bcep18194_B2236	modA	Molybdate ABC transporter, substrate-binding protein
	Bcep18194_B2237	modB	Molybdate ABC transporter, permease protein
	Bcep18194_B2238	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD