Regulon of ModE in Burkholderia mallei ATCC 23344
| Regulator type: | Transcription factor |
| TF locus tag: | BMAA0294 |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Regulog: | ModE - Burkholderia |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Burkholderia
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -58
Score: 5.7 Sequence: CGTTATAACCTCGCGTATATTACG
Locus tag: BMAA0299
Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: BMAA0298
Name: modB Funciton: Molybdate ABC transporter, permease protein
Locus tag: BMAA0297
Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein |
|||
|
modA
|
Molybdate ABC transporter, substrate-binding protein
|
||
|
modB
|
Molybdate ABC transporter, permease protein
|
||
|
modC
|
Molybdate ABC transporter, ATP-binding protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |