Regulon of ModE in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_B2851
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Burkholderia
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.8 Sequence: CGTTATAACCTTTCATATATTACG Locus tag: Bxe_B2848 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bxe_B2849 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bxe_B2850 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Bxe_B2848	modA	Molybdate ABC transporter, substrate-binding protein
	Bxe_B2849	modB	Molybdate ABC transporter, permease protein
	Bxe_B2850	modC	Molybdate ABC transporter, ATP-binding protein
Position: -37 Score: 5.1 Sequence: CGTTACGTCGTTCATTTCACAACG Locus tag: Bxe_B1479 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Bxe_B1480 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bxe_B1481 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Bxe_B1479	modB	Molybdate ABC transporter, permease protein
	Bxe_B1480	modA	Molybdate ABC transporter, substrate-binding protein
	Bxe_B1481	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD