Regulon of ModE in Burkholderia pseudomallei K96243

Properties
Regulator type:	Transcription factor
TF locus tag:	BPSS1789
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 5.7 Sequence: CGTTATAACCTCGCGTATATTACG Locus tag: BPSS1786 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: BPSS1787 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: BPSS1788 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	BPSS1786	modA	Molybdate ABC transporter, substrate-binding protein
	BPSS1787	modB	Molybdate ABC transporter, permease protein
	BPSS1788	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD