Regulog IscR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 41 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	4	3
Marinobacter aqueolei	11	4
Marinobacter sp. ELB17	10	3
Oceanobacter sp. RED65	10	3
Oceanospirillum sp. MED92	9	3
Marinomonas sp. MWYL1	11	3
Saccharophagus degradans 2-40	12	4
Teredinibacter turnerae T7901	11	3
Cellvibrio japonicus Ueda107	11	4
Chromohalobacter salexigens DSM 3043	4	2
Reinekea sp. MED297	12	4
Alcanivorax borkumensis SK2	11	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
erpA	* Hahella chejuensis KCTC 2396 Site: position = -103 score = 5.48366 sequence = ATAGTTGACCGATTAAGTAGGATAA Gene: HCH_06242: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Marinobacter aqueolei Site: position = -87 score = 6.03067 sequence = ATAGTTGATTGTTTTAGTCAGGAAT Gene: Maqu_0694: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Marinobacter sp. ELB17 Site: position = -66 score = 6.03067 sequence = ATAGTTGATTGTTTTAGTCAGGAAT Gene: MELB17_20316: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Oceanobacter sp. RED65 Site: position = -70 score = 5.74346 sequence = TTAGTTGACTAGAATACTCGGGTTT Gene: RED65_11832: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Oceanospirillum sp. MED92 Site: position = -61 score = 6.06413 sequence = ATACTTGACTGAATTGCTTGGTTAA Gene: MED92_17445: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Marinomonas sp. MWYL1 Site: position = -66 score = 6.2935 sequence = ATACTTGACTAAATTACTCGGATAA Gene: Mmwyl1_1012: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Saccharophagus degradans 2-40 Site: position = -66 score = 6.10036 sequence = ATACTTGATTGTTTTAGTCGGTTAA Gene: Sde_0836: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Teredinibacter turnerae T7901 Site: position = -86 score = 5.8464 sequence = ATACTTGACTGAAACACTCGGGTAC Gene: TERTU_3061: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Cellvibrio japonicus Ueda107 Site: position = -76 score = 6.00973 sequence = ATAGTTGACTGTTTTGCTGGGGTAA Gene: CJA_0888: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Chromohalobacter salexigens DSM 3043 Site: position = -76 score = 5.50745 sequence = AAAGTTGACCGTTTTGCTTGGTCTT Gene: Csal_3299: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Reinekea sp. MED297 Site: position = -63 score = 6.33485 sequence = ATAGTTGACTGTTTTGCTCAGGTAT Gene: MED297_10476: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Alcanivorax borkumensis SK2 Site: position = 9 score = 5.7525 sequence = ATTCTTGACTGTTTTAGTCGGGTAC Gene: ABO_0362: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

CRON 2.
iscR	* Hahella chejuensis KCTC 2396 Site: position = -59 score = 4.97356 sequence = ATACTTGATCAGTTTGCAGGGTCAT Gene: HCH_04462: Iron-sulfur cluster regulator IscR	* Marinobacter aqueolei Site: position = -78 score = 5.93655 sequence = ATACTTGACTGTTTTAGTTGGTCAA Gene: Maqu_1121: Iron-sulfur cluster regulator IscR	* Marinobacter sp. ELB17 Site: position = -77 score = 6.0661 sequence = ATACTTGACTGAATTAGTAGGTCAA Gene: MELB17_11313: Iron-sulfur cluster regulator IscR	* Oceanobacter sp. RED65 Site: position = -74 score = 6.18819 sequence = AAAGTTGACTAAAATACTCGGGTTT Gene: RED65_06117: Iron-sulfur cluster regulator IscR	* Oceanospirillum sp. MED92 Site: position = -68 score = 5.36451 sequence = TTAATTGACCTTTTTGGTCGGGTAT Gene: MED92_00535: Iron-sulfur cluster regulator IscR	* Marinomonas sp. MWYL1 Site: position = -93 score = 5.50043 sequence = ATAACCTACTAAAATAGTCAGGTAA Site: position = -68 score = 5.34063 sequence = ATACTTGATCAAAACAGTAGGATTT Gene: Mmwyl1_1343: Iron-sulfur cluster regulator IscR	* Saccharophagus degradans 2-40 Site: position = -61 score = 5.99801 sequence = ATACTTGATTGAAATGCTAGGTTAT Gene: Sde_1412: Iron-sulfur cluster regulator IscR	* Teredinibacter turnerae T7901 Site: position = -64 score = 6.0626 sequence = ATAGTTGACCGCATTACTCGGTTAT Gene: TERTU_2649: Iron-sulfur cluster regulator IscR	* Cellvibrio japonicus Ueda107 Site: position = -131 score = 6.12287 sequence = ATAGTTGAGTAAAATACTCGGGTTT Gene: CJA_1465: Iron-sulfur cluster regulator IscR	* Chromohalobacter salexigens DSM 3043 Site: position = -71 score = 4.98502 sequence = ATGGTTGACCGCGTTACTGGGTTTT Gene: Csal_2847: Iron-sulfur cluster regulator IscR	* Reinekea sp. MED297 Site: position = -107 score = 6.33485 sequence = ATAGTTGACTGTTTTGCTCAGGTAT Gene: MED297_14930: Iron-sulfur cluster regulator IscR	* Alcanivorax borkumensis SK2 Site: position = -66 score = 6.01189 sequence = ATACTTGACCAAATTGCTCAGGATT Gene: ABO_1873: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
sufB	Hahella chejuensis KCTC 2396 Gene: HCH_01416: Iron-sulfur cluster assembly protein SufB	* Marinobacter aqueolei Site: position = -223 score = 6.29932 sequence = ATACCTGACTATTTTACTCTGGTAT Gene: Maqu_3151: Iron-sulfur cluster assembly protein SufB	2 Marinobacter sp. ELB17* Gene: MELB17_12967: Iron-sulfur cluster assembly protein SufB Site: position = -131 score = 6.19847 sequence = ATACCTGACTAAAATACTCTGGTAT Gene: MELB17_04217: Iron-sulfur cluster assembly protein SufB	Oceanobacter sp. RED65 Gene: RED65_06107: Iron-sulfur cluster assembly protein SufB	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1344: Iron-sulfur cluster assembly protein SufB	Saccharophagus degradans 2-40 Gene: Sde_1414: Iron-sulfur cluster assembly protein SufB	Teredinibacter turnerae T7901 Gene: TERTU_2647: Iron-sulfur cluster assembly protein SufB	Cellvibrio japonicus Ueda107 Gene: CJA_1467: Iron-sulfur cluster assembly protein SufB	Chromohalobacter salexigens DSM 3043 Gene: Csal_1233: Iron-sulfur cluster assembly protein SufB	Reinekea sp. MED297 Gene: MED297_14940: Iron-sulfur cluster assembly protein SufB	* Alcanivorax borkumensis SK2 Site: position = -45 score = 6.19847 sequence = ATACCCGACTAAATTACTCTGGTAT Gene: ABO_1865: Iron-sulfur cluster assembly protein SufB	Iron-sulfur cluster assembly protein SufB
sufC	Hahella chejuensis KCTC 2396 Gene: HCH_01414: Iron-sulfur cluster assembly ATPase protein SufC	Marinobacter aqueolei Gene: Maqu_3152: Iron-sulfur cluster assembly ATPase protein SufC	2 Marinobacter sp. ELB17 Gene: MELB17_12972: Iron-sulfur cluster assembly ATPase protein SufC Gene: MELB17_04212: Iron-sulfur cluster assembly ATPase protein SufC	Oceanobacter sp. RED65 Gene: RED65_06102: Iron-sulfur cluster assembly ATPase protein SufC	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1345: Iron-sulfur cluster assembly ATPase protein SufC	Saccharophagus degradans 2-40 Gene: Sde_1415: Iron-sulfur cluster assembly ATPase protein SufC	Teredinibacter turnerae T7901 Gene: TERTU_2646: Iron-sulfur cluster assembly ATPase protein SufC	Cellvibrio japonicus Ueda107 Gene: CJA_1468: Iron-sulfur cluster assembly ATPase protein SufC	Chromohalobacter salexigens DSM 3043 Gene: Csal_1234: Iron-sulfur cluster assembly ATPase protein SufC	Reinekea sp. MED297 Gene: MED297_14945: Iron-sulfur cluster assembly ATPase protein SufC	Alcanivorax borkumensis SK2 Gene: ABO_1866: Iron-sulfur cluster assembly ATPase protein SufC	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Hahella chejuensis KCTC 2396 Gene: HCH_01413: Iron-sulfur cluster assembly protein SufD	Marinobacter aqueolei Gene: Maqu_3153: Iron-sulfur cluster assembly protein SufD	2 Marinobacter sp. ELB17 Gene: MELB17_12977: Iron-sulfur cluster assembly protein SufD Gene: MELB17_04207: Iron-sulfur cluster assembly protein SufD	Oceanobacter sp. RED65 Gene: RED65_06097: Iron-sulfur cluster assembly protein SufD	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1346: Iron-sulfur cluster assembly protein SufD	Saccharophagus degradans 2-40 Gene: Sde_1416: Iron-sulfur cluster assembly protein SufD	Teredinibacter turnerae T7901 Gene: TERTU_2645: Iron-sulfur cluster assembly protein SufD	Cellvibrio japonicus Ueda107 Gene: CJA_1469: Iron-sulfur cluster assembly protein SufD	Chromohalobacter salexigens DSM 3043 Gene: Csal_1235: Iron-sulfur cluster assembly protein SufD	Reinekea sp. MED297 Gene: MED297_14950: Iron-sulfur cluster assembly protein SufD	Alcanivorax borkumensis SK2 Gene: ABO_1867: Iron-sulfur cluster assembly protein SufD	Iron-sulfur cluster assembly protein SufD
sufS	Hahella chejuensis KCTC 2396 Gene: HCH_01412: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Marinobacter aqueolei Gene: Maqu_3154: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Marinobacter sp. ELB17 Gene: MELB17_04202: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Oceanobacter sp. RED65 Gene: RED65_06092: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Oceanospirillum sp. MED92 Gene: MED92_10989: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Marinomonas sp. MWYL1 Gene: Mmwyl1_1347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Saccharophagus degradans 2-40 Gene: Sde_1417: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Teredinibacter turnerae T7901 Gene: TERTU_2644: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Cellvibrio japonicus Ueda107 Gene: CJA_1470: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Chromohalobacter salexigens DSM 3043 Gene: Csal_1236: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Reinekea sp. MED297 Gene: MED297_14955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Alcanivorax borkumensis SK2 Gene: ABO_1868: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufA	Hahella chejuensis KCTC 2396 Gene: HCH_01411: Iron binding protein SufA for iron-sulfur cluster assembly	Marinobacter aqueolei Gene: Maqu_3155: Iron binding protein SufA for iron-sulfur cluster assembly	2 Marinobacter sp. ELB17 Gene: MELB17_12982: Iron binding protein SufA for iron-sulfur cluster assembly Gene: MELB17_04197: Iron binding protein SufA for iron-sulfur cluster assembly	Oceanobacter sp. RED65 Gene: RED65_06087: Iron binding protein SufA for iron-sulfur cluster assembly	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1348: Iron binding protein SufA for iron-sulfur cluster assembly	Saccharophagus degradans 2-40 Gene: Sde_1418: Iron binding protein SufA for iron-sulfur cluster assembly	Teredinibacter turnerae T7901 Gene: TERTU_2643: Iron binding protein SufA for iron-sulfur cluster assembly	Cellvibrio japonicus Ueda107 Gene: CJA_1471: Iron binding protein SufA for iron-sulfur cluster assembly	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_14960: Iron binding protein SufA for iron-sulfur cluster assembly	Alcanivorax borkumensis SK2 Gene: ABO_1869: Iron binding protein SufA for iron-sulfur cluster assembly	Iron binding protein SufA for iron-sulfur cluster assembly
sufT	Hahella chejuensis KCTC 2396 Gene: HCH_01409: Iron sulfur cluster assembly protein SufT	Marinobacter aqueolei Gene: Maqu_3156: Iron sulfur cluster assembly protein SufT	Marinobacter sp. ELB17 Gene: MELB17_04192: Iron sulfur cluster assembly protein SufT	Oceanobacter sp. RED65 Gene: RED65_06082: Iron sulfur cluster assembly protein SufT	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1349: Iron sulfur cluster assembly protein SufT	Saccharophagus degradans 2-40 Gene: Sde_1419: Iron sulfur cluster assembly protein SufT	Teredinibacter turnerae T7901 Gene: TERTU_2641: Iron sulfur cluster assembly protein SufT	Cellvibrio japonicus Ueda107 Gene: CJA_1472: Iron sulfur cluster assembly protein SufT	Chromohalobacter salexigens DSM 3043 Gene: Csal_1237: Iron sulfur cluster assembly protein SufT	Reinekea sp. MED297 Gene: MED297_14965: Iron sulfur cluster assembly protein SufT	Alcanivorax borkumensis SK2 Gene: ABO_1870: Iron sulfur cluster assembly protein SufT	Iron sulfur cluster assembly protein SufT
sufE	Hahella chejuensis KCTC 2396 Gene: HCH_01408: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Marinobacter aqueolei Gene: Maqu_3157: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Marinobacter sp. ELB17 Gene: MELB17_04187: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Oceanobacter sp. RED65 Gene: RED65_06067: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_1350: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Saccharophagus degradans 2-40 Gene: Sde_1420: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Teredinibacter turnerae T7901 Gene: TERTU_2640: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	2 Cellvibrio japonicus Ueda107 Gene: CJA_1476: Sulfur acceptor protein SufE for iron-sulfur cluster assembly Gene: CJA_1184: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_14970: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Alcanivorax borkumensis SK2 Gene: ABO_1871: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscS	Hahella chejuensis KCTC 2396 Gene: HCH_04461: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Marinobacter aqueolei Gene: Maqu_1122: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Marinobacter sp. ELB17 Gene: MELB17_11318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Oceanobacter sp. RED65 Gene: RED65_06112: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Oceanospirillum sp. MED92 Gene: MED92_00540: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Marinomonas sp. MWYL1 Gene: Mmwyl1_1351: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Saccharophagus degradans 2-40 Gene: Sde_1413: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Teredinibacter turnerae T7901 Gene: TERTU_2648: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cellvibrio japonicus Ueda107 Gene: CJA_1466: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Chromohalobacter salexigens DSM 3043 Gene: Csal_2848: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Reinekea sp. MED297 Gene: MED297_14935: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Alcanivorax borkumensis SK2 Gene: ABO_1872: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_00545: Iron-sulfur cluster assembly scaffold protein IscU	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_00550: Iron binding protein IscA for iron-sulfur cluster assembly	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_2849: Iron binding protein IscA for iron-sulfur cluster assembly	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_00555: Chaperone protein HscB	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Chaperone protein HscB
hscA	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_00560: Chaperone protein HscA	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Chaperone protein HscA
fdx	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_00565: ferredoxin, 2Fe-2S type, ISC system	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	ferredoxin, 2Fe-2S type, ISC system

CRON 3.
nfuA	* Hahella chejuensis KCTC 2396 Site: position = -86 score = 5.10512 sequence = AAATCCTACTAATTTGCTAAGGCTT Gene: HCH_02543: NfuA Fe-S protein maturation	* Marinobacter aqueolei Site: position = -82 score = 5.54031 sequence = ATGCCCGACTATTTTACTTGGTCTT Gene: Maqu_1525: NfuA Fe-S protein maturation	Marinobacter sp. ELB17 Gene: MELB17_13022: NfuA Fe-S protein maturation	* Oceanobacter sp. RED65 Site: position = -78 score = 5.2824 sequence = ATACCCGAGTAAAAAACTAGGGATT Gene: RED65_07139: NfuA Fe-S protein maturation	* Oceanospirillum sp. MED92 Site: position = -79 score = 6.05126 sequence = ATAGTTGATCAATTTACTCGGGATT Gene: MED92_12256: NfuA Fe-S protein maturation	* Marinomonas sp. MWYL1 Site: position = -93 score = 5.34915 sequence = ATACCCTACTTTTTTACTTGGTCTT Gene: Mmwyl1_2344: NfuA Fe-S protein maturation	* Saccharophagus degradans 2-40 Site: position = -38 score = 5.43569 sequence = ATAACCGACAAATTTACTAGGTCTT Gene: Sde_2009: NfuA Fe-S protein maturation	* Teredinibacter turnerae T7901 Site: position = -69 score = 5.84963 sequence = ATACCCAACTAAATTAGTAGGGTAT Gene: TERTU_2127: NfuA Fe-S protein maturation	* Cellvibrio japonicus Ueda107 Site: position = -66 score = 5.64321 sequence = ATACCCGAGTATTTTAATCAGGTAT Gene: CJA_2541: NfuA Fe-S protein maturation	Chromohalobacter salexigens DSM 3043 Gene: Csal_1888: NfuA Fe-S protein maturation	* Reinekea sp. MED297 Site: position = -86 score = 6.23541 sequence = AAAGCTGACTAAATTACTCAGGTAT Gene: MED297_01820: NfuA Fe-S protein maturation	* Alcanivorax borkumensis SK2 Site: position = -101 score = 5.5031 sequence = GTACCTGACTAAAATAGTCAGGAAA Gene: ABO_1190: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation

CRON 4.
ydhD	Hahella chejuensis KCTC 2396 Gene: HCH_01764: Probable monothiol glutaredoxin ydhD	Marinobacter aqueolei Gene: Maqu_2316: Probable monothiol glutaredoxin ydhD	Marinobacter sp. ELB17 Gene: MELB17_18479: Probable monothiol glutaredoxin ydhD	Oceanobacter sp. RED65 Gene: RED65_00280: Probable monothiol glutaredoxin ydhD	Oceanospirillum sp. MED92 Gene: MED92_02309: Probable monothiol glutaredoxin ydhD	Marinomonas sp. MWYL1 Gene: Mmwyl1_3388: Probable monothiol glutaredoxin ydhD	* Saccharophagus degradans 2-40 Site: position = -68 score = 5.36613 sequence = ATACCCGAGTAAATAACTCAGATTT Gene: Sde_2438: Probable monothiol glutaredoxin ydhD	2 Teredinibacter turnerae T7901 Gene: TERTU_1515: Probable monothiol glutaredoxin ydhD Gene: TERTU_0735: Probable monothiol glutaredoxin ydhD	* Cellvibrio japonicus Ueda107 Site: position = -74 score = 5.97721 sequence = ATACTTGACTGCATTACTTGGTTTT Gene: CJA_2843: Probable monothiol glutaredoxin ydhD	Chromohalobacter salexigens DSM 3043 Gene: Csal_2129: Probable monothiol glutaredoxin ydhD	* Reinekea sp. MED297 Site: position = -25 score = 5.40641 sequence = ATATCTGAGCGATTTGGTAGGTTAT Gene: MED297_14062: Probable monothiol glutaredoxin ydhD	Alcanivorax borkumensis SK2 Gene: ABO_0722: Probable monothiol glutaredoxin ydhD	Probable monothiol glutaredoxin ydhD

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --