Regulog IscR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 4 | 3 |
| Marinobacter aqueolei | 11 | 4 |
| Marinobacter sp. ELB17 | 10 | 3 |
| Oceanobacter sp. RED65 | 10 | 3 |
| Oceanospirillum sp. MED92 | 9 | 3 |
| Marinomonas sp. MWYL1 | 11 | 3 |
| Saccharophagus degradans 2-40 | 12 | 4 |
| Teredinibacter turnerae T7901 | 11 | 3 |
| Cellvibrio japonicus Ueda107 | 11 | 4 |
| Chromohalobacter salexigens DSM 3043 | 4 | 2 |
| Reinekea sp. MED297 | 12 | 4 |
| Alcanivorax borkumensis SK2 | 11 | 4 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| erpA |
*
Hahella chejuensis KCTC 2396 Site: position = -103 score = 5.48366 sequence = ATAGTTGACCGATTAAGTAGGATAA Gene: HCH_06242: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Marinobacter aqueolei Site: position = -87 score = 6.03067 sequence = ATAGTTGATTGTTTTAGTCAGGAAT Gene: Maqu_0694: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Marinobacter sp. ELB17 Site: position = -66 score = 6.03067 sequence = ATAGTTGATTGTTTTAGTCAGGAAT Gene: MELB17_20316: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Oceanobacter sp. RED65 Site: position = -70 score = 5.74346 sequence = TTAGTTGACTAGAATACTCGGGTTT Gene: RED65_11832: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Oceanospirillum sp. MED92 Site: position = -61 score = 6.06413 sequence = ATACTTGACTGAATTGCTTGGTTAA Gene: MED92_17445: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Marinomonas sp. MWYL1 Site: position = -66 score = 6.2935 sequence = ATACTTGACTAAATTACTCGGATAA Gene: Mmwyl1_1012: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Saccharophagus degradans 2-40 Site: position = -66 score = 6.10036 sequence = ATACTTGATTGTTTTAGTCGGTTAA Gene: Sde_0836: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Teredinibacter turnerae T7901 Site: position = -86 score = 5.8464 sequence = ATACTTGACTGAAACACTCGGGTAC Gene: TERTU_3061: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Cellvibrio japonicus Ueda107 Site: position = -76 score = 6.00973 sequence = ATAGTTGACTGTTTTGCTGGGGTAA Gene: CJA_0888: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Chromohalobacter salexigens DSM 3043 Site: position = -76 score = 5.50745 sequence = AAAGTTGACCGTTTTGCTTGGTCTT Gene: Csal_3299: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Reinekea sp. MED297 Site: position = -63 score = 6.33485 sequence = ATAGTTGACTGTTTTGCTCAGGTAT Gene: MED297_10476: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Alcanivorax borkumensis SK2 Site: position = 9 score = 5.7525 sequence = ATTCTTGACTGTTTTAGTCGGGTAC Gene: ABO_0362: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
| CRON 2. | |||||||||||||
| iscR |
*
Hahella chejuensis KCTC 2396 Site: position = -59 score = 4.97356 sequence = ATACTTGATCAGTTTGCAGGGTCAT Gene: HCH_04462: Iron-sulfur cluster regulator IscR |
*
Marinobacter aqueolei Site: position = -78 score = 5.93655 sequence = ATACTTGACTGTTTTAGTTGGTCAA Gene: Maqu_1121: Iron-sulfur cluster regulator IscR |
*
Marinobacter sp. ELB17 Site: position = -77 score = 6.0661 sequence = ATACTTGACTGAATTAGTAGGTCAA Gene: MELB17_11313: Iron-sulfur cluster regulator IscR |
*
Oceanobacter sp. RED65 Site: position = -74 score = 6.18819 sequence = AAAGTTGACTAAAATACTCGGGTTT Gene: RED65_06117: Iron-sulfur cluster regulator IscR |
*
Oceanospirillum sp. MED92 Site: position = -68 score = 5.36451 sequence = TTAATTGACCTTTTTGGTCGGGTAT Gene: MED92_00535: Iron-sulfur cluster regulator IscR |
*
Marinomonas sp. MWYL1 Site: position = -93 score = 5.50043 sequence = ATAACCTACTAAAATAGTCAGGTAA Site: position = -68 score = 5.34063 sequence = ATACTTGATCAAAACAGTAGGATTT Gene: Mmwyl1_1343: Iron-sulfur cluster regulator IscR |
*
Saccharophagus degradans 2-40 Site: position = -61 score = 5.99801 sequence = ATACTTGATTGAAATGCTAGGTTAT Gene: Sde_1412: Iron-sulfur cluster regulator IscR |
*
Teredinibacter turnerae T7901 Site: position = -64 score = 6.0626 sequence = ATAGTTGACCGCATTACTCGGTTAT Gene: TERTU_2649: Iron-sulfur cluster regulator IscR |
*
Cellvibrio japonicus Ueda107 Site: position = -131 score = 6.12287 sequence = ATAGTTGAGTAAAATACTCGGGTTT Gene: CJA_1465: Iron-sulfur cluster regulator IscR |
*
Chromohalobacter salexigens DSM 3043 Site: position = -71 score = 4.98502 sequence = ATGGTTGACCGCGTTACTGGGTTTT Gene: Csal_2847: Iron-sulfur cluster regulator IscR |
*
Reinekea sp. MED297 Site: position = -107 score = 6.33485 sequence = ATAGTTGACTGTTTTGCTCAGGTAT Gene: MED297_14930: Iron-sulfur cluster regulator IscR |
*
Alcanivorax borkumensis SK2 Site: position = -66 score = 6.01189 sequence = ATACTTGACCAAATTGCTCAGGATT Gene: ABO_1873: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| sufB |
Gene: HCH_01416: Iron-sulfur cluster assembly protein SufB |
*
Marinobacter aqueolei Site: position = -223 score = 6.29932 sequence = ATACCTGACTATTTTACTCTGGTAT Gene: Maqu_3151: Iron-sulfur cluster assembly protein SufB |
*2
Marinobacter sp. ELB17 Gene: MELB17_12967: Iron-sulfur cluster assembly protein SufB Site: position = -131 score = 6.19847 sequence = ATACCTGACTAAAATACTCTGGTAT Gene: MELB17_04217: Iron-sulfur cluster assembly protein SufB |
Gene: RED65_06107: Iron-sulfur cluster assembly protein SufB |
|
Gene: Mmwyl1_1344: Iron-sulfur cluster assembly protein SufB |
Gene: Sde_1414: Iron-sulfur cluster assembly protein SufB |
Gene: TERTU_2647: Iron-sulfur cluster assembly protein SufB |
Gene: CJA_1467: Iron-sulfur cluster assembly protein SufB |
Gene: Csal_1233: Iron-sulfur cluster assembly protein SufB |
Gene: MED297_14940: Iron-sulfur cluster assembly protein SufB |
*
Alcanivorax borkumensis SK2 Site: position = -45 score = 6.19847 sequence = ATACCCGACTAAATTACTCTGGTAT Gene: ABO_1865: Iron-sulfur cluster assembly protein SufB |
Iron-sulfur cluster assembly protein SufB |
| sufC |
Gene: HCH_01414: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Maqu_3152: Iron-sulfur cluster assembly ATPase protein SufC |
2
Marinobacter sp. ELB17 Gene: MELB17_12972: Iron-sulfur cluster assembly ATPase protein SufC Gene: MELB17_04212: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: RED65_06102: Iron-sulfur cluster assembly ATPase protein SufC |
|
Gene: Mmwyl1_1345: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Sde_1415: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: TERTU_2646: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: CJA_1468: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Csal_1234: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: MED297_14945: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: ABO_1866: Iron-sulfur cluster assembly ATPase protein SufC |
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
Gene: HCH_01413: Iron-sulfur cluster assembly protein SufD |
Gene: Maqu_3153: Iron-sulfur cluster assembly protein SufD |
2
Marinobacter sp. ELB17 Gene: MELB17_12977: Iron-sulfur cluster assembly protein SufD Gene: MELB17_04207: Iron-sulfur cluster assembly protein SufD |
Gene: RED65_06097: Iron-sulfur cluster assembly protein SufD |
|
Gene: Mmwyl1_1346: Iron-sulfur cluster assembly protein SufD |
Gene: Sde_1416: Iron-sulfur cluster assembly protein SufD |
Gene: TERTU_2645: Iron-sulfur cluster assembly protein SufD |
Gene: CJA_1469: Iron-sulfur cluster assembly protein SufD |
Gene: Csal_1235: Iron-sulfur cluster assembly protein SufD |
Gene: MED297_14950: Iron-sulfur cluster assembly protein SufD |
Gene: ABO_1867: Iron-sulfur cluster assembly protein SufD |
Iron-sulfur cluster assembly protein SufD |
| sufS |
Gene: HCH_01412: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Maqu_3154: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: MELB17_04202: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: RED65_06092: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: MED92_10989: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Mmwyl1_1347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Sde_1417: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: TERTU_2644: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: CJA_1470: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Csal_1236: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: MED297_14955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: ABO_1868: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| sufA |
Gene: HCH_01411: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: Maqu_3155: Iron binding protein SufA for iron-sulfur cluster assembly |
2
Marinobacter sp. ELB17 Gene: MELB17_12982: Iron binding protein SufA for iron-sulfur cluster assembly Gene: MELB17_04197: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: RED65_06087: Iron binding protein SufA for iron-sulfur cluster assembly |
|
Gene: Mmwyl1_1348: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: Sde_1418: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: TERTU_2643: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: CJA_1471: Iron binding protein SufA for iron-sulfur cluster assembly |
|
Gene: MED297_14960: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: ABO_1869: Iron binding protein SufA for iron-sulfur cluster assembly |
Iron binding protein SufA for iron-sulfur cluster assembly |
| sufT |
Gene: HCH_01409: Iron sulfur cluster assembly protein SufT |
Gene: Maqu_3156: Iron sulfur cluster assembly protein SufT |
Gene: MELB17_04192: Iron sulfur cluster assembly protein SufT |
Gene: RED65_06082: Iron sulfur cluster assembly protein SufT |
|
Gene: Mmwyl1_1349: Iron sulfur cluster assembly protein SufT |
Gene: Sde_1419: Iron sulfur cluster assembly protein SufT |
Gene: TERTU_2641: Iron sulfur cluster assembly protein SufT |
Gene: CJA_1472: Iron sulfur cluster assembly protein SufT |
Gene: Csal_1237: Iron sulfur cluster assembly protein SufT |
Gene: MED297_14965: Iron sulfur cluster assembly protein SufT |
Gene: ABO_1870: Iron sulfur cluster assembly protein SufT |
Iron sulfur cluster assembly protein SufT |
| sufE |
Gene: HCH_01408: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: Maqu_3157: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: MELB17_04187: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: RED65_06067: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
Gene: Mmwyl1_1350: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: Sde_1420: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: TERTU_2640: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
2
Cellvibrio japonicus Ueda107 Gene: CJA_1476: Sulfur acceptor protein SufE for iron-sulfur cluster assembly Gene: CJA_1184: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
Gene: MED297_14970: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: ABO_1871: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
| iscS |
Gene: HCH_04461: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Maqu_1122: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MELB17_11318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: RED65_06112: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MED92_00540: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Mmwyl1_1351: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Sde_1413: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: TERTU_2648: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: CJA_1466: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Csal_2848: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MED297_14935: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: ABO_1872: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
|
|
|
|
Gene: MED92_00545: Iron-sulfur cluster assembly scaffold protein IscU |
|
|
|
|
|
|
|
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
|
|
|
|
Gene: MED92_00550: Iron binding protein IscA for iron-sulfur cluster assembly |
|
|
|
|
Gene: Csal_2849: Iron binding protein IscA for iron-sulfur cluster assembly |
|
|
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
|
|
|
|
Gene: MED92_00555: Chaperone protein HscB |
|
|
|
|
|
|
|
Chaperone protein HscB |
| hscA |
|
|
|
|
Gene: MED92_00560: Chaperone protein HscA |
|
|
|
|
|
|
|
Chaperone protein HscA |
| fdx |
|
|
|
|
Gene: MED92_00565: ferredoxin, 2Fe-2S type, ISC system |
|
|
|
|
|
|
|
ferredoxin, 2Fe-2S type, ISC system |
| CRON 3. | |||||||||||||
| nfuA |
*
Hahella chejuensis KCTC 2396 Site: position = -86 score = 5.10512 sequence = AAATCCTACTAATTTGCTAAGGCTT Gene: HCH_02543: NfuA Fe-S protein maturation |
*
Marinobacter aqueolei Site: position = -82 score = 5.54031 sequence = ATGCCCGACTATTTTACTTGGTCTT Gene: Maqu_1525: NfuA Fe-S protein maturation |
Gene: MELB17_13022: NfuA Fe-S protein maturation |
*
Oceanobacter sp. RED65 Site: position = -78 score = 5.2824 sequence = ATACCCGAGTAAAAAACTAGGGATT Gene: RED65_07139: NfuA Fe-S protein maturation |
*
Oceanospirillum sp. MED92 Site: position = -79 score = 6.05126 sequence = ATAGTTGATCAATTTACTCGGGATT Gene: MED92_12256: NfuA Fe-S protein maturation |
*
Marinomonas sp. MWYL1 Site: position = -93 score = 5.34915 sequence = ATACCCTACTTTTTTACTTGGTCTT Gene: Mmwyl1_2344: NfuA Fe-S protein maturation |
*
Saccharophagus degradans 2-40 Site: position = -38 score = 5.43569 sequence = ATAACCGACAAATTTACTAGGTCTT Gene: Sde_2009: NfuA Fe-S protein maturation |
*
Teredinibacter turnerae T7901 Site: position = -69 score = 5.84963 sequence = ATACCCAACTAAATTAGTAGGGTAT Gene: TERTU_2127: NfuA Fe-S protein maturation |
*
Cellvibrio japonicus Ueda107 Site: position = -66 score = 5.64321 sequence = ATACCCGAGTATTTTAATCAGGTAT Gene: CJA_2541: NfuA Fe-S protein maturation |
Gene: Csal_1888: NfuA Fe-S protein maturation |
*
Reinekea sp. MED297 Site: position = -86 score = 6.23541 sequence = AAAGCTGACTAAATTACTCAGGTAT Gene: MED297_01820: NfuA Fe-S protein maturation |
*
Alcanivorax borkumensis SK2 Site: position = -101 score = 5.5031 sequence = GTACCTGACTAAAATAGTCAGGAAA Gene: ABO_1190: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
| CRON 4. | |||||||||||||
| ydhD |
Gene: HCH_01764: Probable monothiol glutaredoxin ydhD |
Gene: Maqu_2316: Probable monothiol glutaredoxin ydhD |
Gene: MELB17_18479: Probable monothiol glutaredoxin ydhD |
Gene: RED65_00280: Probable monothiol glutaredoxin ydhD |
Gene: MED92_02309: Probable monothiol glutaredoxin ydhD |
Gene: Mmwyl1_3388: Probable monothiol glutaredoxin ydhD |
*
Saccharophagus degradans 2-40 Site: position = -68 score = 5.36613 sequence = ATACCCGAGTAAATAACTCAGATTT Gene: Sde_2438: Probable monothiol glutaredoxin ydhD |
2
Teredinibacter turnerae T7901 Gene: TERTU_1515: Probable monothiol glutaredoxin ydhD Gene: TERTU_0735: Probable monothiol glutaredoxin ydhD |
*
Cellvibrio japonicus Ueda107 Site: position = -74 score = 5.97721 sequence = ATACTTGACTGCATTACTTGGTTTT Gene: CJA_2843: Probable monothiol glutaredoxin ydhD |
Gene: Csal_2129: Probable monothiol glutaredoxin ydhD |
*
Reinekea sp. MED297 Site: position = -25 score = 5.40641 sequence = ATATCTGAGCGATTTGGTAGGTTAT Gene: MED297_14062: Probable monothiol glutaredoxin ydhD |
Gene: ABO_0722: Probable monothiol glutaredoxin ydhD |
Probable monothiol glutaredoxin ydhD |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |