Regulon of IscR in Hahella chejuensis KCTC 2396

Properties
Regulator type:	Transcription factor
TF locus tag:	HCH_04462
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 41 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.5 Sequence: ATAGTTGACCGATTAAGTAGGATAA Locus tag: HCH_06242 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	HCH_06242	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -86 Score: 5.1 Sequence: AAATCCTACTAATTTGCTAAGGCTT Locus tag: HCH_02543 Name: nfuA Funciton: NfuA Fe-S protein maturation
	HCH_02543	nfuA	NfuA Fe-S protein maturation
Position: -59 Score: 5 Sequence: ATACTTGATCAGTTTGCAGGGTCAT Locus tag: HCH_04462 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: HCH_04461 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	HCH_04462	iscR	Iron-sulfur cluster regulator IscR
	HCH_04461	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD