Regulon of IscR in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_1412
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 41 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.4 Sequence: ATACCCGAGTAAATAACTCAGATTT Locus tag: Sde_2438 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	Sde_2438	ydhD	Probable monothiol glutaredoxin ydhD
Position: -66 Score: 6.1 Sequence: ATACTTGATTGTTTTAGTCGGTTAA Locus tag: Sde_0836 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Sde_0836	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -38 Score: 5.4 Sequence: ATAACCGACAAATTTACTAGGTCTT Locus tag: Sde_2009 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Sde_2009	nfuA	NfuA Fe-S protein maturation
Position: -61 Score: 6 Sequence: ATACTTGATTGAAATGCTAGGTTAT Locus tag: Sde_1412 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Sde_1413 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Sde_1414 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: Sde_1415 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: Sde_1416 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: Sde_1417 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: Sde_1418 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly Locus tag: Sde_1419 Name: sufT Funciton: Iron sulfur cluster assembly protein SufT Locus tag: Sde_1420 Name: sufE Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
	Sde_1412	iscR	Iron-sulfur cluster regulator IscR
	Sde_1413	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Sde_1414	sufB	Iron-sulfur cluster assembly protein SufB
	Sde_1415	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	Sde_1416	sufD	Iron-sulfur cluster assembly protein SufD
	Sde_1417	sufS	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	Sde_1418	sufA	Iron binding protein SufA for iron-sulfur cluster assembly
	Sde_1419	sufT	Iron sulfur cluster assembly protein SufT
	Sde_1420	sufE	Sulfur acceptor protein SufE for iron-sulfur cluster assembly

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD