Regulog Zur - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 10 | 6 |
| Caulobacter segnis ATCC 21756 | 9 | 5 |
| Caulobacter sp. K31 | 5 | 3 |
| Phenylobacterium zucineum HLK1 | 2 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| znuL |
*
Caulobacter crescentus CB15 Site: position = -66 score = 6.2668 sequence = GATACGTTATTTCATAACAGTCT Gene: CC0214: Zinc-regulated TonB-dependent outer membrane transporter |
*
Caulobacter segnis ATCC 21756 Site: position = -70 score = 6.28954 sequence = GATATGTTATTTCATAACAGCTA Gene: Cseg_3938: Zinc-regulated TonB-dependent outer membrane transporter |
*
Caulobacter sp. K31 Site: position = -62 score = 6.59686 sequence = GATATGTTATTTCATAACACTTC Gene: Caul_4694: Zinc-regulated TonB-dependent outer membrane transporter |
*
Phenylobacterium zucineum HLK1 Site: position = -19 score = 6.24672 sequence = GTTATGTTATTTCATAACAGTGA Gene: PHZ_c0823: Zinc-regulated TonB-dependent outer membrane transporter |
Zinc-regulated TonB-dependent outer membrane transporter |
| CRON 2. | |||||
| znuK |
*
Caulobacter crescentus CB15 Site: position = -97 score = 5.90658 sequence = GTGATGTTATATCATAACAATTG Gene: CC1517: Zinc-regulated TonB-dependent outer membrane transporter |
*
Caulobacter segnis ATCC 21756 Site: position = -96 score = 6.06986 sequence = GTAATGTTATATCGTAACAATTA Gene: Cseg_3085: Zinc-regulated TonB-dependent outer membrane transporter |
|
|
Zinc-regulated TonB-dependent outer membrane transporter |
| CRON 3. | |||||
| rplU |
*
Caulobacter crescentus CB15 Site: position = -191 score = 5.77883 sequence = AGCGTGTTATAAAGTAACATTCC Gene: CC0319: 50S ribosomal protein L21 |
*
Caulobacter segnis ATCC 21756 Site: position = -191 score = 5.63562 sequence = AGCGTGTTATAAAGTAACACACC Gene: Cseg_3837: 50S ribosomal protein L21 |
*
Caulobacter sp. K31 Site: position = -174 score = 5.88769 sequence = AGACTGTTATATTGTAACACGCC Gene: Caul_0194: 50S ribosomal protein L21 |
Gene: PHZ_c0258: 50S ribosomal protein L21 |
50S ribosomal protein L21 |
| rpmA |
Gene: CC0318: 50S ribosomal protein L27 |
Gene: Cseg_3838: 50S ribosomal protein L27 |
Gene: Caul_0193: 50S ribosomal protein L27 |
Gene: PHZ_c0257: 50S ribosomal protein L27 |
50S ribosomal protein L27 |
| CRON 4. | |||||
| zrpW |
*
Caulobacter crescentus CB15 Site: position = -35 score = 6.33458 sequence = GGAATGTTACTTTATAACACGCT Gene: CC0320: Conserved hypothetical protein CC0320 |
*
Caulobacter segnis ATCC 21756 Site: position = -36 score = 6.38871 sequence = GGTGTGTTACTTTATAACACGCT Gene: Cseg_3836: Conserved hypothetical protein CC0320 |
*
Caulobacter sp. K31 Site: position = -35 score = 6.16018 sequence = GGCGTGTTACAATATAACAGTCT Gene: Caul_0195: Conserved hypothetical protein CC0320 |
|
Conserved hypothetical protein CC0320 |
| yciC |
Gene: CC0321: Putative zinc chaperone, COG0523 family |
Gene: Cseg_3835: Putative zinc chaperone, COG0523 family |
Gene: Caul_0196: Putative zinc chaperone, COG0523 family |
*
Phenylobacterium zucineum HLK1 Site: position = -75 score = 5.83937 sequence = CATGTGTTACTTTATAACATCCC Gene: PHZ_c3369: Putative zinc chaperone, COG0523 family |
Putative zinc chaperone, COG0523 family |
| CRON 5. | |||||
| znuM |
*
Caulobacter crescentus CB15 Site: position = -35 score = 4.06894 sequence = CCCCTGTTACAGAATAACAGGGG Gene: CC0663: Zinc-regulated TonB-dependent outer membrane transporter |
|
|
Gene: PHZ_c1090: Zinc-regulated TonB-dependent outer membrane transporter |
Zinc-regulated TonB-dependent outer membrane transporter |
| CRON 6. | |||||
| znuG |
*
Caulobacter crescentus CB15 Site: position = -73 score = 4.30095 sequence = CAATTGTTATGATATAACATCAC Gene: CC1518: Zinc-regulated ABC transporter, ATP-binding protein |
*
Caulobacter segnis ATCC 21756 Site: position = -65 score = 4.17665 sequence = TAATTGTTACGATATAACATTAC Gene: Cseg_3084: Zinc-regulated ABC transporter, ATP-binding protein |
|
|
Zinc-regulated ABC transporter, ATP-binding protein |
| znuH |
Gene: CC1519: Zinc-regulated ABC transporter, permease component |
Gene: Cseg_3083: Zinc-regulated ABC transporter, permease component |
|
|
Zinc-regulated ABC transporter, permease component |
| znuI |
Gene: CC1520: Zinc-regulated ABC transporter, permease component |
Gene: Cseg_3082: Zinc-regulated ABC transporter, permease component |
|
|
Zinc-regulated ABC transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |