Regulog Zur - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	10	6
Caulobacter segnis ATCC 21756	9	5
Caulobacter sp. K31	5	3
Phenylobacterium zucineum HLK1	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
znuL	* Caulobacter crescentus CB15 Site: position = -66 score = 6.2668 sequence = GATACGTTATTTCATAACAGTCT Gene: CC0214: Zinc-regulated TonB-dependent outer membrane transporter	* Caulobacter segnis ATCC 21756 Site: position = -70 score = 6.28954 sequence = GATATGTTATTTCATAACAGCTA Gene: Cseg_3938: Zinc-regulated TonB-dependent outer membrane transporter	* Caulobacter sp. K31 Site: position = -62 score = 6.59686 sequence = GATATGTTATTTCATAACACTTC Gene: Caul_4694: Zinc-regulated TonB-dependent outer membrane transporter	* Phenylobacterium zucineum HLK1 Site: position = -19 score = 6.24672 sequence = GTTATGTTATTTCATAACAGTGA Gene: PHZ_c0823: Zinc-regulated TonB-dependent outer membrane transporter	Zinc-regulated TonB-dependent outer membrane transporter

CRON 2.
znuK	* Caulobacter crescentus CB15 Site: position = -97 score = 5.90658 sequence = GTGATGTTATATCATAACAATTG Gene: CC1517: Zinc-regulated TonB-dependent outer membrane transporter	* Caulobacter segnis ATCC 21756 Site: position = -96 score = 6.06986 sequence = GTAATGTTATATCGTAACAATTA Gene: Cseg_3085: Zinc-regulated TonB-dependent outer membrane transporter	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	Zinc-regulated TonB-dependent outer membrane transporter

CRON 3.
rplU	* Caulobacter crescentus CB15 Site: position = -191 score = 5.77883 sequence = AGCGTGTTATAAAGTAACATTCC Gene: CC0319: 50S ribosomal protein L21	* Caulobacter segnis ATCC 21756 Site: position = -191 score = 5.63562 sequence = AGCGTGTTATAAAGTAACACACC Gene: Cseg_3837: 50S ribosomal protein L21	* Caulobacter sp. K31 Site: position = -174 score = 5.88769 sequence = AGACTGTTATATTGTAACACGCC Gene: Caul_0194: 50S ribosomal protein L21	Phenylobacterium zucineum HLK1 Gene: PHZ_c0258: 50S ribosomal protein L21	50S ribosomal protein L21
rpmA	Caulobacter crescentus CB15 Gene: CC0318: 50S ribosomal protein L27	Caulobacter segnis ATCC 21756 Gene: Cseg_3838: 50S ribosomal protein L27	Caulobacter sp. K31 Gene: Caul_0193: 50S ribosomal protein L27	Phenylobacterium zucineum HLK1 Gene: PHZ_c0257: 50S ribosomal protein L27	50S ribosomal protein L27

CRON 4.
zrpW	* Caulobacter crescentus CB15 Site: position = -35 score = 6.33458 sequence = GGAATGTTACTTTATAACACGCT Gene: CC0320: Conserved hypothetical protein CC0320	* Caulobacter segnis ATCC 21756 Site: position = -36 score = 6.38871 sequence = GGTGTGTTACTTTATAACACGCT Gene: Cseg_3836: Conserved hypothetical protein CC0320	* Caulobacter sp. K31 Site: position = -35 score = 6.16018 sequence = GGCGTGTTACAATATAACAGTCT Gene: Caul_0195: Conserved hypothetical protein CC0320	Phenylobacterium zucineum HLK1	Conserved hypothetical protein CC0320
yciC	Caulobacter crescentus CB15 Gene: CC0321: Putative zinc chaperone, COG0523 family	Caulobacter segnis ATCC 21756 Gene: Cseg_3835: Putative zinc chaperone, COG0523 family	Caulobacter sp. K31 Gene: Caul_0196: Putative zinc chaperone, COG0523 family	* Phenylobacterium zucineum HLK1 Site: position = -75 score = 5.83937 sequence = CATGTGTTACTTTATAACATCCC Gene: PHZ_c3369: Putative zinc chaperone, COG0523 family	Putative zinc chaperone, COG0523 family

CRON 5.
znuM	* Caulobacter crescentus CB15 Site: position = -35 score = 4.06894 sequence = CCCCTGTTACAGAATAACAGGGG Gene: CC0663: Zinc-regulated TonB-dependent outer membrane transporter	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1 Gene: PHZ_c1090: Zinc-regulated TonB-dependent outer membrane transporter	Zinc-regulated TonB-dependent outer membrane transporter

CRON 6.
znuG	* Caulobacter crescentus CB15 Site: position = -73 score = 4.30095 sequence = CAATTGTTATGATATAACATCAC Gene: CC1518: Zinc-regulated ABC transporter, ATP-binding protein	* Caulobacter segnis ATCC 21756 Site: position = -65 score = 4.17665 sequence = TAATTGTTACGATATAACATTAC Gene: Cseg_3084: Zinc-regulated ABC transporter, ATP-binding protein	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	Zinc-regulated ABC transporter, ATP-binding protein
znuH	Caulobacter crescentus CB15 Gene: CC1519: Zinc-regulated ABC transporter, permease component	Caulobacter segnis ATCC 21756 Gene: Cseg_3083: Zinc-regulated ABC transporter, permease component	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	Zinc-regulated ABC transporter, permease component
znuI	Caulobacter crescentus CB15 Gene: CC1520: Zinc-regulated ABC transporter, permease component	Caulobacter segnis ATCC 21756 Gene: Cseg_3082: Zinc-regulated ABC transporter, permease component	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	Zinc-regulated ABC transporter, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Caulobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --