Regulon of Zur in Caulobacter crescentus CB15

Properties
Regulator type:	Transcription factor
TF locus tag:	CC0357
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Caulobacterales
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.3 Sequence: GGAATGTTACTTTATAACACGCT Locus tag: CC0320 Name: zrpW Funciton: Conserved hypothetical protein CC0320 Locus tag: CC0321 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	CC0320	zrpW	Conserved hypothetical protein CC0320
	CC0321	yciC	Putative zinc chaperone, COG0523 family
Position: -97 Score: 5.9 Sequence: GTGATGTTATATCATAACAATTG Locus tag: CC1517 Name: znuK Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	CC1517	znuK	Zinc-regulated TonB-dependent outer membrane transporter
Position: -66 Score: 6.3 Sequence: GATACGTTATTTCATAACAGTCT Locus tag: CC0214 Name: znuL Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	CC0214	znuL	Zinc-regulated TonB-dependent outer membrane transporter
Position: -73 Score: 4.3 Sequence: CAATTGTTATGATATAACATCAC Locus tag: CC1518 Name: znuG Funciton: Zinc-regulated ABC transporter, ATP-binding protein Locus tag: CC1519 Name: znuH Funciton: Zinc-regulated ABC transporter, permease component Locus tag: CC1520 Name: znuI Funciton: Zinc-regulated ABC transporter, permease component
	CC1518	znuG	Zinc-regulated ABC transporter, ATP-binding protein
	CC1519	znuH	Zinc-regulated ABC transporter, permease component
	CC1520	znuI	Zinc-regulated ABC transporter, permease component
Position: -35 Score: 4.1 Sequence: CCCCTGTTACAGAATAACAGGGG Locus tag: CC0663 Name: znuM Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	CC0663	znuM	Zinc-regulated TonB-dependent outer membrane transporter
Position: -191 Score: 5.8 Sequence: AGCGTGTTATAAAGTAACATTCC Locus tag: CC0319 Name: rplU Funciton: 50S ribosomal protein L21 Locus tag: CC0318 Name: rpmA Funciton: 50S ribosomal protein L27
	CC0319	rplU	50S ribosomal protein L21
	CC0318	rpmA	50S ribosomal protein L27

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD