Regulon of Zur in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_0255
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Caulobacterales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -174 Score: 5.9 Sequence: AGACTGTTATATTGTAACACGCC Locus tag: Caul_0194 Name: rplU Funciton: 50S ribosomal protein L21 Locus tag: Caul_0193 Name: rpmA Funciton: 50S ribosomal protein L27
	Caul_0194	rplU	50S ribosomal protein L21
	Caul_0193	rpmA	50S ribosomal protein L27
Position: -62 Score: 6.6 Sequence: GATATGTTATTTCATAACACTTC Locus tag: Caul_4694 Name: znuL Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	Caul_4694	znuL	Zinc-regulated TonB-dependent outer membrane transporter
Position: -35 Score: 6.2 Sequence: GGCGTGTTACAATATAACAGTCT Locus tag: Caul_0195 Name: zrpW Funciton: Conserved hypothetical protein CC0320 Locus tag: Caul_0196 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Caul_0195	zrpW	Conserved hypothetical protein CC0320
	Caul_0196	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD