Regulon of Zur in Caulobacter segnis ATCC 21756

Properties
Regulator type:	Transcription factor
TF locus tag:	Cseg_3781
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Caulobacterales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 6.4 Sequence: GGTGTGTTACTTTATAACACGCT Locus tag: Cseg_3836 Name: zrpW Funciton: Conserved hypothetical protein CC0320 Locus tag: Cseg_3835 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Cseg_3836	zrpW	Conserved hypothetical protein CC0320
	Cseg_3835	yciC	Putative zinc chaperone, COG0523 family
Position: -191 Score: 5.6 Sequence: AGCGTGTTATAAAGTAACACACC Locus tag: Cseg_3837 Name: rplU Funciton: 50S ribosomal protein L21 Locus tag: Cseg_3838 Name: rpmA Funciton: 50S ribosomal protein L27
	Cseg_3837	rplU	50S ribosomal protein L21
	Cseg_3838	rpmA	50S ribosomal protein L27
Position: -96 Score: 6.1 Sequence: GTAATGTTATATCGTAACAATTA Locus tag: Cseg_3085 Name: znuK Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	Cseg_3085	znuK	Zinc-regulated TonB-dependent outer membrane transporter
Position: -70 Score: 6.3 Sequence: GATATGTTATTTCATAACAGCTA Locus tag: Cseg_3938 Name: znuL Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	Cseg_3938	znuL	Zinc-regulated TonB-dependent outer membrane transporter
Position: -65 Score: 4.2 Sequence: TAATTGTTACGATATAACATTAC Locus tag: Cseg_3084 Name: znuG Funciton: Zinc-regulated ABC transporter, ATP-binding protein Locus tag: Cseg_3083 Name: znuH Funciton: Zinc-regulated ABC transporter, permease component Locus tag: Cseg_3082 Name: znuI Funciton: Zinc-regulated ABC transporter, permease component
	Cseg_3084	znuG	Zinc-regulated ABC transporter, ATP-binding protein
	Cseg_3083	znuH	Zinc-regulated ABC transporter, permease component
	Cseg_3082	znuI	Zinc-regulated ABC transporter, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD