Regulog Zur - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | 5 | 1 |
| Thauera sp. MZ1T | 9 | 2 |
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | 1 | 1 |
| Nitrosospira multiformis ATCC 25196 | 3 | 1 |
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | ||
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | 10 | 3 |
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| omr |
|
|
|
|
|
|
|
|
|
*
Methylobacillus flagellatus KT Site: position = -11 score = 6.39724 sequence = AATATGCCACAATGTTGCATTAC Gene: Mfla_0708: Predicted zinc-related TonB-dependent outer membrane transporter |
|
|
Predicted zinc-related TonB-dependent outer membrane transporter |
| zip |
|
|
|
|
|
|
|
|
|
Gene: Mfla_0707: Zinc transporter, ZIP family |
|
|
Zinc transporter, ZIP family |
| PF10986 |
|
*
Thauera sp. MZ1T Site: position = -99 score = 6.36925 sequence = TTGATGCAACATTGTAGCATTAG Gene: Tmz1t_3495: Predicted ABC transport system, substrate-binding protein |
|
|
|
|
|
|
|
Gene: Mfla_0706: Predicted ABC transport system, substrate-binding protein |
|
|
Predicted ABC transport system, substrate-binding protein |
| COG1124 |
|
Gene: Tmz1t_3494: Predicted ABC transport system, ATP-binding protein |
|
|
|
|
|
|
|
Gene: Mfla_0705: Predicted ABC transport system, ATP-binding protein |
|
|
Predicted ABC transport system, ATP-binding protein |
| COG0577 |
|
Gene: Tmz1t_3493: Predicted ABC transport system, permease protein |
|
|
|
|
|
|
|
Gene: Mfla_0704: Predicted ABC transport system, permease protein |
|
|
Predicted ABC transport system, permease protein |
| PF11736 |
|
Gene: Tmz1t_3492: Lipoprotein, putative |
|
|
|
|
|
|
|
Gene: Mfla_0703: Lipoprotein, putative |
|
|
Lipoprotein, putative |
| CRON 2. | |||||||||||||
| dksA2 |
|
|
|
|
|
Gene: Tbd_2533: DnaK suppressor protein |
|
|
|
*
Methylobacillus flagellatus KT Site: position = -34 score = 7.00683 sequence = AAAATGCAACATTGTTGCATTAT Site: position = -72 score = 6.59421 sequence = TAATTGCAACATAGTTGCATATA Gene: Mfla_1232: DnaK suppressor protein |
|
|
DnaK suppressor protein |
| yciC2 |
|
|
|
|
|
Gene: Tbd_2534: Putative zinc chaperone, COG0523 family |
|
|
|
Gene: Mfla_1231: Putative zinc chaperone, COG0523 family |
|
|
Putative zinc chaperone, COG0523 family |
| yciC3 |
|
|
|
|
|
|
|
|
|
Gene: Mfla_1230: Putative zinc chaperone, COG0523 family |
Gene: Mmol_1305: Putative zinc chaperone, COG0523 family |
|
Putative zinc chaperone, COG0523 family |
| CRON 3. | |||||||||||||
| zur |
*
Azoarcus sp. EbN1 Site: position = 2 score = 6.76534 sequence = GAAATGCTACAATGTTGCATTAG Gene: ebA1809: Zinc uptake regulation protein Zur |
*
Thauera sp. MZ1T Site: position = -81 score = 6.50627 sequence = CTAATGCTACAATGTTGCATCAA Gene: Tmz1t_3496: Zinc uptake regulation protein Zur |
|
Gene: NE1722: Zinc uptake regulation protein Zur |
*
Nitrosospira multiformis ATCC 25196 Site: position = 145 score = 4.93381 sequence = TAAATGCAACTCTGTTGCAAACT Gene: Nmul_A2512: ferric uptake regulator, FUR family |
|
|
|
|
Gene: Mfla_1233: Zinc uptake regulation protein Zur |
Gene: Mmol_1304: Zinc uptake regulation protein Zur |
|
Zinc uptake regulation protein Zur |
| Tmz1t_3497 |
|
Gene: Tmz1t_3497: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| znuC |
Gene: ebA1812: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Tmz1t_3498: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
Gene: CV3066: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: NMB0588: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: LHK_01347: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: ebA1813: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Tmz1t_3499: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
Gene: CV3065: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: NMB0587: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: LHK_01348: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| znuA |
Gene: ebA1814: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Tmz1t_3500: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
Gene: CV3064: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: NMB0586: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: LHK_01349: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| ebA1811 |
Gene: ebA1811: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| Nmul_A2511 |
|
|
|
|
Gene: Nmul_A2511: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| omr2 |
|
|
|
*
Nitrosomonas europaea ATCC 19718 Site: position = -193 score = 6.39209 sequence = TAATTGCAACAATGTTGCGGCTA Site: position = -233 score = 6.59734 sequence = TAATTGCAACATAGTTGCGTTTT Gene: NE1721: Predicted zinc-related TonB-dependent outer membrane transporter |
Gene: Nmul_A2510: Predicted zinc-related TonB-dependent outer membrane transporter |
|
|
|
|
|
|
|
Predicted zinc-related TonB-dependent outer membrane transporter |
| CRON 4. | |||||||||||||
| rpmJ2 |
|
|
|
|
|
|
|
Gene: NMB0941: 50S ribosomal protein L36 paralog |
|
*
Methylobacillus flagellatus KT Site: position = -73 score = 6.13483 sequence = AATATGCAACAATGTTGCAATTT Gene: Mfla_1288: 50S ribosomal protein L36 paralog |
|
|
50S ribosomal protein L36 paralog |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |