Regulon of Zur in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_3496
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Various betaproteobacteria
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 6.4 Sequence: TTGATGCAACATTGTAGCATTAG Locus tag: Tmz1t_3495 Name: PF10986 Funciton: Predicted ABC transport system, substrate-binding protein Locus tag: Tmz1t_3494 Name: COG1124 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Tmz1t_3493 Name: COG0577 Funciton: Predicted ABC transport system, permease protein Locus tag: Tmz1t_3492 Name: PF11736 Funciton: Lipoprotein, putative
	Tmz1t_3495	PF10986	Predicted ABC transport system, substrate-binding protein
	Tmz1t_3494	COG1124	Predicted ABC transport system, ATP-binding protein
	Tmz1t_3493	COG0577	Predicted ABC transport system, permease protein
	Tmz1t_3492	PF11736	Lipoprotein, putative
Position: -81 Score: 6.5 Sequence: CTAATGCTACAATGTTGCATCAA Locus tag: Tmz1t_3496 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Tmz1t_3497 Name: Tmz1t_3497 Funciton: Hypothetical protein Locus tag: Tmz1t_3498 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Tmz1t_3499 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Tmz1t_3500 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Tmz1t_3496	zur	Zinc uptake regulation protein Zur
	Tmz1t_3497	Tmz1t_3497	Hypothetical protein
	Tmz1t_3498	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Tmz1t_3499	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Tmz1t_3500	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD