Regulon of Zur in Methylobacillus flagellatus KT

Properties
Regulator type:	Transcription factor
TF locus tag:	Mfla_1233
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Various betaproteobacteria
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.1 Sequence: AATATGCAACAATGTTGCAATTT Locus tag: Mfla_1288 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	Mfla_1288	rpmJ2	50S ribosomal protein L36 paralog
Position: -72 Score: 6.6 Sequence: TAATTGCAACATAGTTGCATATA Position: -34 Score: 7 Sequence: AAAATGCAACATTGTTGCATTAT Locus tag: Mfla_1232 Name: dksA2 Funciton: DnaK suppressor protein Locus tag: Mfla_1231 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family Locus tag: Mfla_1230 Name: yciC3 Funciton: Putative zinc chaperone, COG0523 family
	Mfla_1232	dksA2	DnaK suppressor protein
	Mfla_1231	yciC2	Putative zinc chaperone, COG0523 family
	Mfla_1230	yciC3	Putative zinc chaperone, COG0523 family
Position: -11 Score: 6.4 Sequence: AATATGCCACAATGTTGCATTAC Locus tag: Mfla_0708 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Mfla_0707 Name: zip Funciton: Zinc transporter, ZIP family Locus tag: Mfla_0706 Name: PF10986 Funciton: Predicted ABC transport system, substrate-binding protein Locus tag: Mfla_0705 Name: COG1124 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Mfla_0704 Name: COG0577 Funciton: Predicted ABC transport system, permease protein Locus tag: Mfla_0703 Name: PF11736 Funciton: Lipoprotein, putative
	Mfla_0708	omr	Predicted zinc-related TonB-dependent outer membrane transporter
	Mfla_0707	zip	Zinc transporter, ZIP family
	Mfla_0706	PF10986	Predicted ABC transport system, substrate-binding protein
	Mfla_0705	COG1124	Predicted ABC transport system, ATP-binding protein
	Mfla_0704	COG0577	Predicted ABC transport system, permease protein
	Mfla_0703	PF11736	Lipoprotein, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD