Regulon of Zur in Nitrosomonas europaea ATCC 19718

Properties
Regulator type:	Transcription factor
TF locus tag:	NE1722
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Various betaproteobacteria
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -233 Score: 6.6 Sequence: TAATTGCAACATAGTTGCGTTTT Position: -193 Score: 6.4 Sequence: TAATTGCAACAATGTTGCGGCTA Locus tag: NE1721 Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	NE1721	omr2	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD