Regulon of Zur in Nitrosospira multiformis ATCC 25196
| Regulator type: | Transcription factor |
| TF locus tag: | Nmul_A2512 |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Regulog: | Zur - Various betaproteobacteria |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: 145
Score: 4.9 Sequence: TAAATGCAACTCTGTTGCAAACT
Locus tag: Nmul_A2512
Name: null Funciton: ferric uptake regulator, FUR family
Locus tag: Nmul_A2511
Name: null Funciton: hypothetical protein
Locus tag: Nmul_A2510
Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter |
|||
|
ferric uptake regulator, FUR family
|
|||
|
hypothetical protein
|
|||
|
omr2
|
Predicted zinc-related TonB-dependent outer membrane transporter
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |