Regulon of Zur in Nitrosospira multiformis ATCC 25196

Properties
Regulator type:	Transcription factor
TF locus tag:	Nmul_A2512
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Various betaproteobacteria
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 145 Score: 4.9 Sequence: TAAATGCAACTCTGTTGCAAACT Locus tag: Nmul_A2512 Name: null Funciton: ferric uptake regulator, FUR family Locus tag: Nmul_A2511 Name: null Funciton: hypothetical protein Locus tag: Nmul_A2510 Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	Nmul_A2512		ferric uptake regulator, FUR family
	Nmul_A2511		hypothetical protein
	Nmul_A2510	omr2	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD