Regulog Zur - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	7	1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1	4	1
Polaromonas naphthalenivorans CJ2	8	2
Polaromonas sp. JS666	7	1
Rhodoferax ferrireducens DSM 15236	4	2
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
zur	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -50 score = 6.83864 sequence = ATAATGCAACACGATTGCATTAA Gene: Aave_2813: Zinc uptake regulation protein Zur	Acidovorax sp. JS42	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = -72 score = 6.85897 sequence = ATAATGCAACCCGGTTGCGATAA Gene: Daci_3951: Zinc uptake regulation protein Zur	* Polaromonas naphthalenivorans CJ2 Site: position = -77 score = 6.50607 sequence = ATAATGCAACCTGATTGCGATAG Site: position = -45 score = 6.63858 sequence = GTAACGCAACTGAATTGCATTAA Gene: Pnap_1145: Zinc uptake regulation protein Zur	* Polaromonas sp. JS666 Site: position = 27 score = 6.95651 sequence = ATAATGCAACTAGATTGCGTTAT Gene: Bpro_1677: Zinc uptake regulation protein Zur	* Rhodoferax ferrireducens DSM 15236 Site: position = -81 score = 6.89298 sequence = ATAATGCAACTGAATTGCGATAT Site: position = -55 score = 6.80061 sequence = TTAACGCAACTCAATTGCAATAA Gene: Rfer_2054: Zinc uptake regulation protein Zur	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Zinc uptake regulation protein Zur
COG2884	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2812: ABC transporter-related protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1146: ABC transporter-related protein	Polaromonas sp. JS666 Gene: Bpro_1678: ABC transporter-related protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1564: ABC transporter-related protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3395: ABC transporter-related protein	Methylibium petroleiphilum PM1 Gene: Mpe_A1826: ABC transporter-related protein	Leptothrix cholodnii SP-6 Gene: Lcho_3558: ABC transporter-related protein	ABC transporter-related protein
COG4591	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2811: Predicted ABC transport system, permease protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1147: Predicted ABC transport system, permease protein	Polaromonas sp. JS666 Gene: Bpro_1679: Predicted ABC transport system, permease protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1563: Predicted ABC transport system, permease protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3394: Predicted ABC transport system, permease protein	Methylibium petroleiphilum PM1 Gene: Mpe_A1825: Predicted ABC transport system, permease protein	Leptothrix cholodnii SP-6 Gene: Lcho_3557: Predicted ABC transport system, permease protein	Predicted ABC transport system, permease protein
Aave_2810	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2810: Conserved hypothetical protein	Acidovorax sp. JS42 Gene: Ajs_2031: Conserved hypothetical protein	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_3950: Conserved hypothetical protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1148: Conserved hypothetical protein	Polaromonas sp. JS666 Gene: Bpro_1680: Conserved hypothetical protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Conserved hypothetical protein
PF11736	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2809: Lipoprotein, putative	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1149: Lipoprotein, putative	Polaromonas sp. JS666 Gene: Bpro_1681: Lipoprotein, putative	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1562: Lipoprotein, putative	Verminephrobacter eiseniae EF01-2 Gene: Veis_3393: Lipoprotein, putative	Methylibium petroleiphilum PM1 Gene: Mpe_A1829: Lipoprotein, putative	Leptothrix cholodnii SP-6 Gene: Lcho_3556: Lipoprotein, putative	Lipoprotein, putative
COG4531	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2808: Predicted zinc-binding periplasmic protein	Acidovorax sp. JS42 Gene: Ajs_2032: Predicted zinc-binding periplasmic protein	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1826: Predicted zinc-binding periplasmic protein	Delftia acidovorans SPH-1 Gene: Daci_3949: Predicted zinc-binding periplasmic protein	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1682: Predicted zinc-binding periplasmic protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_3718: Predicted zinc-binding periplasmic protein	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A2933: Predicted zinc-binding periplasmic protein	Leptothrix cholodnii SP-6	Predicted zinc-binding periplasmic protein
omr	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2807: Predicted zinc-regulated TonB-dependent outer membrane transporter	Acidovorax sp. JS42 Gene: Ajs_2033: Predicted zinc-regulated TonB-dependent outer membrane transporter	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1825: Predicted zinc-regulated TonB-dependent outer membrane transporter	Delftia acidovorans SPH-1 Gene: Daci_3948: Predicted zinc-regulated TonB-dependent outer membrane transporter	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1683: Predicted zinc-regulated TonB-dependent outer membrane transporter	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_3717: Predicted zinc-regulated TonB-dependent outer membrane transporter	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A2932: Predicted zinc-regulated TonB-dependent outer membrane transporter	Leptothrix cholodnii SP-6	Predicted zinc-regulated TonB-dependent outer membrane transporter

CRON 2.
znuC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	* Polaromonas naphthalenivorans CJ2 Site: position = -251 score = 6.54155 sequence = TTAATGCAATTCAGTTGCGTTAC Site: position = -219 score = 6.12467 sequence = CTATCGCAATCAGGTTGCATTAT Gene: Pnap_1144: Zinc ABC transporter, ATP-binding protein ZnuC	Polaromonas sp. JS666	* Rhodoferax ferrireducens DSM 15236 Site: position = -251 score = 6.62261 sequence = ATATCGCAATTCAGTTGCATTAT Site: position = -277 score = 6.38423 sequence = TTATTGCAATTGAGTTGCGTTAA Gene: Rfer_2053: Zinc ABC transporter, ATP-binding protein ZnuC	Variovorax paradoxus S110 Gene: Vapar_2782: Zinc ABC transporter, ATP-binding protein ZnuC	Verminephrobacter eiseniae EF01-2 Gene: Veis_3390: Zinc ABC transporter, ATP-binding protein ZnuC	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_3562: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1143: Zinc ABC transporter, inner membrane permease protein ZnuB	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2052: Zinc ABC transporter, inner membrane permease protein ZnuB	Variovorax paradoxus S110 Gene: Vapar_2783: Zinc ABC transporter, inner membrane permease protein ZnuB	Verminephrobacter eiseniae EF01-2 Gene: Veis_3391: Zinc ABC transporter, inner membrane permease protein ZnuB	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_3561: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB
znuA	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1142: Zinc ABC transporter, periplasmic-binding protein ZnuA	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2051: Zinc ABC transporter, periplasmic-binding protein ZnuA	Variovorax paradoxus S110 Gene: Vapar_2784: Zinc ABC transporter, periplasmic-binding protein ZnuA	Verminephrobacter eiseniae EF01-2 Gene: Veis_3392: Zinc ABC transporter, periplasmic-binding protein ZnuA	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_3560: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --