Regulon of Zur in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_3951
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.9 Sequence: ATAATGCAACCCGGTTGCGATAA Locus tag: Daci_3951 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Daci_3950 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Daci_3949 Name: COG4531 Funciton: Predicted zinc-binding periplasmic protein Locus tag: Daci_3948 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Daci_3951	zur	Zinc uptake regulation protein Zur
	Daci_3950	Aave_2810	Conserved hypothetical protein
	Daci_3949	COG4531	Predicted zinc-binding periplasmic protein
	Daci_3948	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD