Regulon of Zur in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aave_2813
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 6.8 Sequence: ATAATGCAACACGATTGCATTAA Locus tag: Aave_2813 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Aave_2812 Name: COG2884 Funciton: ABC transporter-related protein Locus tag: Aave_2811 Name: COG4591 Funciton: Predicted ABC transport system, permease protein Locus tag: Aave_2810 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Aave_2809 Name: PF11736 Funciton: Lipoprotein, putative Locus tag: Aave_2808 Name: COG4531 Funciton: Predicted zinc-binding periplasmic protein Locus tag: Aave_2807 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Aave_2813	zur	Zinc uptake regulation protein Zur
	Aave_2812	COG2884	ABC transporter-related protein
	Aave_2811	COG4591	Predicted ABC transport system, permease protein
	Aave_2810	Aave_2810	Conserved hypothetical protein
	Aave_2809	PF11736	Lipoprotein, putative
	Aave_2808	COG4531	Predicted zinc-binding periplasmic protein
	Aave_2807	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD