Regulon of Zur in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_1145
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Comamonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 6.5 Sequence: ATAATGCAACCTGATTGCGATAG Position: -45 Score: 6.6 Sequence: GTAACGCAACTGAATTGCATTAA Locus tag: Pnap_1145 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Pnap_1146 Name: COG2884 Funciton: ABC transporter-related protein Locus tag: Pnap_1147 Name: COG4591 Funciton: Predicted ABC transport system, permease protein Locus tag: Pnap_1148 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Pnap_1149 Name: PF11736 Funciton: Lipoprotein, putative
	Pnap_1145	zur	Zinc uptake regulation protein Zur
	Pnap_1146	COG2884	ABC transporter-related protein
	Pnap_1147	COG4591	Predicted ABC transport system, permease protein
	Pnap_1148	Aave_2810	Conserved hypothetical protein
	Pnap_1149	PF11736	Lipoprotein, putative
Position: -251 Score: 6.5 Sequence: TTAATGCAATTCAGTTGCGTTAC Position: -219 Score: 6.1 Sequence: CTATCGCAATCAGGTTGCATTAT Locus tag: Pnap_1144 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Pnap_1143 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Pnap_1142 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Pnap_1144	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Pnap_1143	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Pnap_1142	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD