Regulon of Zur in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_2054
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 6.9 Sequence: ATAATGCAACTGAATTGCGATAT Position: -55 Score: 6.8 Sequence: TTAACGCAACTCAATTGCAATAA Locus tag: Rfer_2054 Name: zur Funciton: Zinc uptake regulation protein Zur
	Rfer_2054	zur	Zinc uptake regulation protein Zur
Position: -277 Score: 6.4 Sequence: TTATTGCAATTGAGTTGCGTTAA Position: -251 Score: 6.6 Sequence: ATATCGCAATTCAGTTGCATTAT Locus tag: Rfer_2053 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Rfer_2052 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Rfer_2051 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Rfer_2053	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Rfer_2052	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Rfer_2051	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD