Regulog YhgD - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | 1 | 1 |
| Bacillus amyloliquefaciens FZB42 | 2 | 2 |
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | 2 | 1 |
| Bacillus licheniformis DSM 13 | 2 | 1 |
| Bacillus pumilus SAFR-032 | 2 | 2 |
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Geobacillus kaustophilus HTA426 | 3 | 3 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yhgD |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -42 score = 5.8216 sequence = TGACTAAAACGTTCAAACGGTCA Gene: RBAM_010380: Transcriptional regulator, TetR family |
*
Bacillus cereus ATCC 14579 Site: position = -40 score = 6.32857 sequence = TGACTATATTATCCAATTGGTCA Gene: BC1077: Transcriptional regulator, TetR family |
|
*
Bacillus halodurans C-125 Site: position = -48 score = 6.38973 sequence = TGACCATTTTGTTCATTTGGTCA Gene: BH2145: Transcriptional regulator, TetR family |
*
Bacillus licheniformis DSM 13 Site: position = -41 score = 6.17567 sequence = TGACCAAAATGTTCAAATAGTCA Gene: BLi01095: Transcriptional regulator, TetR family |
*
Bacillus pumilus SAFR-032 Site: position = -39 score = 5.99492 sequence = TGACCAAAACGTTCAAATAGTCA Gene: BPUM_0961: Transcriptional regulator, TetR family |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -40 score = 6.00235 sequence = TGACTAAAATGTTCAAACGGTCA Gene: BSU10150: Transcriptional regulator, TetR family |
*
Geobacillus kaustophilus HTA426 Site: position = -41 score = 6.53167 sequence = TGACCAAATTGTTCATTTAGTCA Gene: GK0664: Transcriptional regulator, TetR family |
|
*
Paenibacillus sp. JDR-2 Site: position = -66 score = 4.71741 sequence = TGACCGAAATTGATTTTTAGTCA Gene: Pjdr2_1195: Transcriptional regulator, TetR family |
Transcriptional regulator, TetR family |
| yhgE |
*
Anoxybacillus flavithermus WK1 Site: position = -48 score = 6.44921 sequence = TGACTAAATGAACAAATTGGTCA Gene: Aflv_2276: Predicted membrane protein |
*
Bacillus amyloliquefaciens FZB42 Site: position = -46 score = 5.77579 sequence = TGACCGTTTTGTCAAATGAGTCA Gene: RBAM_010390: Predicted membrane protein |
*
Bacillus cereus ATCC 14579 Site: position = -46 score = 6.25813 sequence = TGACTATATGAACATTTTGGTCA Site: position = -191 score = 6.06248 sequence = TGACCAAATGAACAATGCGGTCA Gene: BC1078: Predicted membrane protein |
|
Gene: BH2146: Predicted membrane protein |
Gene: BLi01096: Predicted membrane protein |
*
Bacillus pumilus SAFR-032 Site: position = -47 score = 5.97268 sequence = TGACCAAATTGTATATTTAGTCA Gene: BPUM_0962: Predicted membrane protein |
Gene: BSU10160: Predicted membrane protein |
*2
Geobacillus kaustophilus HTA426 Site: position = 11 score = 6.05395 sequence = TGACCATACGGACAATTTGGTCA Gene: GK0665: Predicted membrane protein Site: position = -272 score = 6.16018 sequence = TGACCGAAACGTCCATTTGGTCA Site: position = -49 score = 6.35022 sequence = TGACTAAATGGACAAATCGGTCA Gene: GK0328: Predicted membrane protein |
|
*2
Paenibacillus sp. JDR-2 Gene: Pjdr2_6058: Predicted membrane protein Site: position = -58 score = 5.30807 sequence = TGACCGAAATACGAATTTAGTCA Gene: Pjdr2_1196: Predicted membrane protein |
Predicted membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |