Regulon of YhgD in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH2145
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	YhgD - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.4 Sequence: TGACCATTTTGTTCATTTGGTCA Locus tag: BH2145 Name: yhgD Funciton: Transcriptional regulator, TetR family Locus tag: BH2146 Name: yhgE Funciton: Predicted membrane protein
	BH2145	yhgD	Transcriptional regulator, TetR family
	BH2146	yhgE	Predicted membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD