Regulon of YhgD in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_1195
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	YhgD - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 4.7 Sequence: TGACCGAAATTGATTTTTAGTCA Locus tag: Pjdr2_1195 Name: yhgD Funciton: Transcriptional regulator, TetR family
	Pjdr2_1195	yhgD	Transcriptional regulator, TetR family
Position: -58 Score: 5.3 Sequence: TGACCGAAATACGAATTTAGTCA Locus tag: Pjdr2_1196 Name: yhgE Funciton: Predicted membrane protein
	Pjdr2_1196	yhgE	Predicted membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD