Regulon of YhgD in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC1077
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	YhgD - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.3 Sequence: TGACTATATTATCCAATTGGTCA Locus tag: BC1077 Name: yhgD Funciton: Transcriptional regulator, TetR family
	BC1077	yhgD	Transcriptional regulator, TetR family
Position: -191 Score: 6.1 Sequence: TGACCAAATGAACAATGCGGTCA Position: -46 Score: 6.3 Sequence: TGACTATATGAACATTTTGGTCA Locus tag: BC1078 Name: yhgE Funciton: Predicted membrane protein
	BC1078	yhgE	Predicted membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD